Dataset for CDS BMF of organism Gouania willdenowi

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C5HAH2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gouania willdenowi GN=BMF (length=489 residues).
atggacgatgaggaagatgatgtgtttgagccagaccccctctgctggcgcactgcgttcaaggagataaagtgcgaaga
ccgggtcacgcagacacctggtcctgccctggtacacagcggcatgctgccgtgtggcgtcgcagaggaaccaaggtcac
tcttccacggtaacgcaggttttcggctacactttcccgcacactttgaacttgttggggagcaccaatcaagtccaccg
gagagcgaagagcagcgaaacaccatggagcacctgcccaggcggccatctgtggcacacagcgtggaggctcgcatcgg
acagaagctccagctcattggagaccagtttcacagggaacacctgcaacggtatcatcgaaaccaaaggaataatgggc
cggtatggtggcgcttggccgcaaccctcctgggccttctttttgaccggggattcattgctggaggaggcggtgcagga
cggaggtga
© 1998-2022Legal notice