Dataset for CDS PMAIP1 of organism Gopherus evgoodei

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C4WNF3_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gopherus evgoodei GN=PMAIP1 (length=141 residues).
atgactggttttcctttgtgttttacagcacaggaagctgtgacgcagtgctctttgcaactacgcaaaataggagatat
atgcaacctgcagcagaagattcttaacgttattacaaaactgttctgcccaggaacgtga
© 1998-2022Legal notice