Dataset for CDS BMF of organism Ficedula albicollis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3JS06_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ficedula albicollis GN=BMF (length=603 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccacggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctggctttgtgttggatccgcacctccaagaggaacctcaggaaggtcagc
gggaagcacgtgctgaggtgcagattgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacacggaggtgaacag
gaaccacactgggcagagggataacgggaatttacacagctga
© 1998-2022Legal notice