Dataset for CDS PMAIP1 of organism Electrophorus electricus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A4W4H0G9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Electrophorus electricus GN=PMAIP1 (length=216 residues).
aaacaagcaggaactagtcccgtgacaccatgtcaattaatttcttggctttccgacctctttctagagcaaaccgttgt
gtctgaatgtgcgtgccagctgcgcagaatgggagatctgatcaactggaaatacttgttgctgcatttgattgctgacg
ctcgtacacgtctgggaatatgcagtggtaatgatgttgttgctttgtgcatgtag
© 1998-2020Legal notice