Dataset for CDS BMF of organism Electrophorus electricus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A4W4DZH9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Electrophorus electricus GN=BMF (length=471 residues).
atggatgacgaagaggatgatgtgttcaggattgccgcacagtactggccacactccctccgtgagataaagcaagaaga
gcgtggcacacagactgcagggcggccactggcgaggcccaacggcatgctgccgtgcggcgtgtccgaagagccccgac
gcctcttctacggtagtgcaggactgctcctgctagcaccacctgcacgccccaacagtgcagacgacgccatgctccca
gagaaccagctggctgtggagcctccccggcggaggcccctccatagcgtggaggccagcattggtcaaaagctccagat
gattggcgaccagttctatcaagaacacatgctgcaacaccgaaaccaaaggaaccatcagccattttggttgcgtttgg
cctctgcattgtatgtgctcctgtttgagagggagcctgcagctcgctggaggggggtggaccagaggtga
© 1998-2020Legal notice