Dataset for CDS Unclassified of organism Cyprinus carpio

[Download (right click)]

12 sequence(s)

>gnl|bcl2dbcds|A0A8C1K2C2_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Cyprinus carpio (length=537 residues).
atgtctgacacgtccagagagcaaacgccgggtaatggcccggcgtcgcggggaagcggagagagcgccggtggcggagc
tgcctcgcgctctgggcactttgacttccctcagccgagcgatggggacccgttaaggggagggatttccatgtcgaata
gtcaccagtcgaggtcaccgatgtgccgaaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtg
ccaggttccccgctaatgcccaatatttccgaggcgcaagacggccaaaatgatgagctatggtttgccgaacctagcca
ccagcccgcgcagatggcagcacctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggag
acgagttcaaccgtctgtactgtcagggggatgggaacaacggggcccagctgcgtgctcccaacgaacacgccatcatc
atgtggatgaacgaccttattggacgtgtagtacagtttttcctgcgaagaagatga
>gnl|bcl2dbcds|A0A8C1K2C2_uncBCL2L11-02 Putative BCL2-like 11 gene OS=[Eukaryota] Cyprinus carpio (length=537 residues).
ttagctgatgtttccttttgtcaaacgccgggtaatggcccggcgtcgcggggaagcggagagagcgccggtggcggagc
tgcctcgcgctctgggcactttgacttccctcagccgagcgatggggacccgttaaggggagggatttccatgtcgaata
gtcaccagtcgaggtcaccgatgtgccgaaccttctccaggtcctctagtggctatttttccgtcgacagcgattctgtg
ccaggttccccgctaatgcccaatatttccgaggcgcaagacggccaaaatgatgagctatggtttgccgaacctagcca
ccagcccgcgcagatggcagcacctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggag
acgagttcaaccgtctgtactgtcagggggatgggaacaacggggcccagctgcgtgctcccaacgaacacgccatcatc
atgtggatgaacgaccttattggacgtgtagtacagtttttcctgcgaagaagatga
>gnl|bcl2dbcds|A0A8C1K2C2_uncBCL2L11-03 Putative BCL2-like 11 gene OS=[Eukaryota] Cyprinus carpio (length=285 residues).
ctttttgataccaaatatatatcaatgaaaaacaaaatattttttctatggtttgccgaacctagccaccagcccgcgca
gatggcagcacctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggagacgagttcaacc
gtctgtactgtcagggggatgggaacaacggggcccagctgcgtgctcccaacgaacacgccatcatcatgtggatgaac
gaccttattggacgtgtagtacagtttttcctgcgaagaagatga
>gnl|bcl2dbcds|A0A8C1KDX2_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Cyprinus carpio (length=711 residues).
atggatgatgaagaggacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
gagaagtggagaggtgggaaaaacagctaacagacacggacgctttaaagacagatcaacacagactgccagctctgtgc
tgaattcagcgagagacggagatatggcaccattccagggtttagagagagatgcatcacctccctgcagatctgtggat
gccaggacagcatttggtgctaactgtggaaccgggggcctagcgtcacttactattgcccctggggccccagaagggcc
aagagcactttttcatggaaatgctggatttcgtgcacacttccccgcactgtttgaacccgtcctggatggcacacaaa
acgcagaagaggacgaagggagaccagaagaaaaggaagaggaacgtgacatgggaattagtgtggagattcagattgga
cgtaaactgcgtgaaatgggggatcagtttcagcaggatcatcttcagctggtaagagtgatttcagatgagaaaagttt
gtttcttttcctcaaggccgatttgaatcaaacggggttaaacagaaccacaagtccgtggtttctgtcacgatgtgcag
tgacatcatcgtccgttcaatgctgcatatgcaaatgctcagtgggagagatgacatcattattggtttag
>gnl|bcl2dbcds|A0A8C1M381_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Cyprinus carpio (length=336 residues).
atggatgaggatgaggatgatgtgcacaggaagggtctacagcactggccttcttcccaggttcagataaagcagaccga
tacggcagggagagcccctgtatcgcccgacagcatgctgccctgccgagtgcatgtggagcccagacgctttctctacg
gtaacgcaggactgctgctgctagcgtcgctcagccgctctcggcctccacacgtggttctccggcagaacctgcgcatg
atggacccggaggagagcgtggagaccctcatcgggcagaagctccattaccaagacaacctttctcattctgttgaact
tgatgtattaaaataa
>gnl|bcl2dbcds|A0A8C1QJR9_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Cyprinus carpio (length=717 residues).
atggatgatgaggaggatgaacagcttcctcactgttgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
cccacgaggagaggtgggacaaacggctaacagacacggacgctttgaagacagatcaacgcagactgccagaactgtgc
tgaattcagcgagagacagagatatggcaccattccagggtctagagagagatgcatcatctccctgcagagctgtggag
gccaggactgcatttggggctaactgtggaactgggggcctcgcatcacttactatggcccctggggccccagaagggcc
aagagcactttttcatggaaatgctggatttcgttcacacttccccgcactgttcgaacccgtcccggatggaacacaaa
acacggaagaggatgaagggagaccagaagaaaaggaagacgaacgtgacgtgggaattagtgtggagattcagattgga
cgtaaactgcgtgaaatgggggatcagtttcagctggaacatcttcagctggtaagagtgatttcagatgagacaaggcc
gattctgtggttttcattgcagtggtttctgtcacgatgtgcaatgacatcatcatctgttatttcaatgctgcatatgc
aaatgctcattgggagagatgacatcatttttggtttacccgaattatatggtgtttttgttgtagtaaaaaactag
>gnl|bcl2dbcds|A0A8C1TKB8_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Cyprinus carpio (length=657 residues).
atggatgatgaggaggacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
gagaagtggagaggtgggaaaaacagctaacagacacggacgctttaaagacagatcaacacagactgccagctctgtgc
tgaattcagcgagagacagagatatggcaccattccagggtttagagagagatgcatcatctccctgcagatctgtggat
gccaggacagcatttggtgctaactgtggaaccgggggcctagcgtcacttactattgcccctggggccccagaagggcc
aagagcactttttcatggaaatgctggatttcgtgcacacttccccgcactgtttgaacccgtcctggatggcacacaaa
acgcagaagaggacgaagggagaccagaagaaaaggaagaggaacgtgacgtgggaattagtgtggagattcagattgga
cgtaaactgcgtgaaatgggggatcagtttcagcaggatcatcttcagctggtaagagtgatttcagatcagaaaagttt
tccgtggtttctgtcacgatgtgcagtgacatcatcgtccgttcaatgctgcatatgcaaatgctcagtgggagagatga
catcattattggtttag
>gnl|bcl2dbcds|A0A8C2BTF4_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Cyprinus carpio (length=717 residues).
atggatgatgaggaggatgaacagcttcctcactgttgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
cccacgagtagaggtgggacaaacggctaacagacacggacgctttgaagacagatcaacgcagactgccagaactgtgc
tgaattcagcgagagacagagatatggcaccattccagggtttagcgagagatgcatcatctccctgcagatctgtggat
gccaggacagcatttggtgctaactgtggaaccgggggcctagcgtcacttactattgcccctggggccccagaagggcc
aagagcactttttcatggaaatgctggatttcgttcacacttccccgcactgttcgaacctgtcccggatggcacacaaa
acacggaagaggacgaagggagaccagaagaaaaggaagacgaacgtgacgtgggaattagtgtggagattcagattgga
cgtaaactgcgtgaaatgggggatcagtttcagctggaacatcttcagctggtaagagtgatttcagatgagacaaggcc
gattctgtggttttcattgcagtggtttctgtcacgatgtgcaatgacatcatcatctgttatttcaatgctgcatatgc
aaatgctcattgggagagatgacataatttttggtttacccgaattatatggtgtttttgttgtagtaaaaaactag
>gnl|bcl2dbcds|A0A8C2F9E7_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Cyprinus carpio (length=657 residues).
atggatgatgaggaggacgaacagcttcctcactgctgtgaaacaccgctaagaaacaagagctcagagaacagagacgg
gagaagtggagaggtgggaaaaacagctaacagacacggacgctttaaagacagatcaacacagactgccagctctgtgc
tgaattcagcgagagacagagatatggcaccattccagggtttagcgagagatgcatcatctccctgcagatctgtggat
gccaggacagcatttggtgctaactgtggaaccgggggcctagcgtcacttactattgcccctggggccccagaagggcc
aagagcactttttcatggaaatgctggatttcgtgcacacttccccgcactgtttgaacccgtcctggatggcacacaaa
acgcagaagaggacgaagggagaccagaagaaaaggaagaggaacgtgacgtgggaattagtgtggagattcagattgga
cgtaaactgcgtgaaatgggggatcagtttcagcaggatcatcttcagctggtaagagtgatttcagatgagaaaagttt
tccgtggtttctgtcacgatgtgcagtgacatcatcgtccgttcaatgctgcatatgcaaatgctcagtgggagagatga
catcattattggtttag
>gnl|bcl2dbcds|A0A8C2IKZ4_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Cyprinus carpio (length=546 residues).
atgtctgacacgtccagagagcaaacgctggccaacggcccggcctcgcggggaggcggagagagcgccggtggcggagc
ggtcttgcgcaccgaacactttgacttccctcagccgagcgaaggggactcgttaaggggagggatttccatgtctaata
gtcaccagtcgaggtcaccgatgtcccgaaccttctccaggtcttctagtggctatttttccgtcgacagcgattctgtg
ccaagttccccgctaatgcccaatatttccgaagcgcaagacgaccaaaatgatgaggtatggtttgacgaacctagcca
ccagcacgtgcagatggcagcacctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggag
acgagttcaaccgtctgtactgtcagggggccggtgcaggcgggaacaacgcggtccagctgcacgctcccaacgaacac
gccatcatcatatggatgaacgaccttatcggacgtgtagtacagtttttcctgcgaaggagatga
>gnl|bcl2dbcds|A0A8C2IKZ4_uncBCL2L11-02 Putative BCL2-like 11 gene OS=[Eukaryota] Cyprinus carpio (length=546 residues).
gattccgatacagcgcgagagcaaacgctggccaacggcccggcctcgcggggaggcggagagagcgccggtggcggagc
ggtcttgcgcaccgaacactttgacttccctcagccgagcgaaggggactcgttaaggggagggatttccatgtctaata
gtcaccagtcgaggtcaccgatgtcccgaaccttctccaggtcttctagtggctatttttccgtcgacagcgattctgtg
ccaagttccccgctaatgcccaatatttccgaagcgcaagacgaccaaaatgatgaggtatggtttgacgaacctagcca
ccagcacgtgcagatggcagcacctgtgggagccatggggccggagatggcggtcgctcgggagctgcggcgcattggag
acgagttcaaccgtctgtactgtcagggggccggtgcaggcgggaacaacgcggtccagctgcacgctcccaacgaacac
gccatcatcatatggatgaacgaccttatcggacgtgtagtacagtttttcctgcgaaggagatga
>gnl|bcl2dbcds|A0A8C2IKZ4_uncBCL2L11-03 Putative BCL2-like 11 gene OS=[Eukaryota] Cyprinus carpio (length=513 residues).
atgtctgacacgtccagagagcaaacgctggccaacggcccggcctcgcggggaggcggagagagcgccggtggcggagc
ggtcttgcgcaccgaacactttgacttccctcagccgagcgaaggggactcgttaaggggagggatttccatgtctaata
gtcaccagtcgaggtcaccgatgtcccgaaccttctccaggtcttctagtggctatttttccgtcgacagcgattctgtg
ccaagttccccgctaatgcccaatatttccgaagcgcaagacgaccaaaatgatgaggtatggtttgacgaacctagcca
ccagcacgttcgactcattcgtctttgtgaaagctgctctaaaagaagcaacctgcatttcctctctgttaacatcagat
tgttcactatgtattttgaagcatgcgcttgcacctgcatgagccttcagcctggttcattcacaatatcttgcaaaccc
ggtgcacctgagacgcatgaccacagcgtgtga
© 1998-2022Legal notice