Dataset for CDS classical BH3-containing proteins of organism Cyclopterus lumpus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3AQA3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cyclopterus lumpus GN=BAD (length=495 residues).
atggctgcacacttcactatttctgacagtgagtcagagccatcggaggaggtagaggaaggagaaaataaccaattatc
ctctatggtagagcagcagcttcgtcaacgccactccctcaccctacctcagctcagattgccagcgaccggtcgaatca
ggctgaactcagagtcccacgcttccaccgtctccagagacgaggagctctggaccgacgaggccggtacgcccaccgac
ggagctccgttcagagtacggtccaagtcggctccccccgctttgtgggcagcaaagaaatacggccggcagctccgaag
gatgagcgacgagttcgacatcctgctcgacaaaggggaaatgaggagggtgaagagtgccgggacggccaaacagatgc
accactctaaaagctggtggagctacctctttagtcaccaggagatagagggagagaacaaccaccatgaaaaccacact
caccgcactgaatag
© 1998-2022Legal notice