Dataset for CDS BCL2L11 of organism Cyanoderma ruficeps

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3NS85_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Cyanoderma ruficeps GN=BCL2L11 (length=561 residues).
atggctaagcagccccccgaggtgaaggcgcgacgcgacggcgagggcgggcggctgccggcggcggaggggccgggccc
gggcgcgcagctgcgccccggcgctcccgccgccttgcccggggccggcccggtgtccgcggccgccgcggcgcggggcc
cgcccgccagccccggccccttcgccacccgctcgccgctcttcatcttcgtgcggaggtcgccgctgctgccgcgctcc
tccagcgggtacttctcgttcgacgccgagcgcagccccgcgcccctgggctgcgacaaggccacgcagacccctagccc
gccctgccaggctctcagccactgcctcagcgccatggcttcccggtggcaatcccattctccagccgaagaggtgcagc
cagaaatctggattgcgcaggagctgcggcgcatcggggacgagttcaatgcctcctattgtccacgcaggggtttcttg
gatcaccaggtgggaaacccccaggtcgtcatcctgcgcctgttgcgttacatcatccgcctcatctggaggttccagtg
a
© 1998-2022Legal notice