Dataset for CDS BMF of organism Crocodylus porosus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A7M4FPU2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Crocodylus porosus GN=BMF (length=582 residues).
atggatccctccagctacctggaagaagactattccagcctggatgggctggatgatgatgtgtttcactctgatgactt
tggactcgcaggtcagcctggtgagatgacctctactggcattttcacacagaaccagtcctacagctgccttttgggga
gatttcaacttttcccacttactcactgctgtggtcctggcagcaggcatactgagcagcaggataaggcaactcaaaca
ctcaacccatcctcttccagtcaggatgtaatgttgccttgtggagtcactgaagagccccagagactcttctatgggaa
cgttgggtaccgtttacgtgttcccccagttggctttgctctgagtccacacctccaagaggaacatcaggaaggtcacc
aagaagtacgtgctgaggtccaaattgcacggaaattacagtgtattgcagaccagttccaccggctccacgtacaaagg
catcagcagaacagaaatcaagtgtggtggcagatacttctcttcctacataatttggccttaaatgtggaggcaaacag
gaatcaagcaggtcagaggtga
© 1998-2021Legal notice