Dataset for CDS BMF of organism Cricetulus griseus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C2MZN7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cricetulus griseus GN=BMF (length=813 residues).
atgcccggagcgggcgtattttggaaacaataccgcgaggtgcgccgtggcctcctcccgcgccagctcgcgcccgcagc
agccactgccccagctcgcgccaccgcctcctgccgcagcccgctggagtttgccccctccttcccaatcgagtgtgggc
gccaagccccccgagtgctcatcaccctggaccctggcgcagagccctggcatcacgactcggaggctgagactctgtcc
tggagtcacccaggagagatggagccacctcagtgtgtggaggagctggaagatgatgtgttccagccagaggatgggga
gccagggacacaacctgggagcttgctctctgctgacctgtttgcccagagccagctggattgtcccctcagtcggcttc
agctctttcctctcactcactgctgtggtcctgggctccggcccataagccaggaagacaaggccacccagaccctcagc
ccagcctccccaagccagggtgttatgctgccttgtggggtcacagaggaaccccagagactcttttacggcaatgctgg
ctacaggcttcctctccctgccagtttccctgcaggcttgccccttggggagcagccccctgaagggcagtggcagcatc
gagcagaggtacagatcgccagaaagcttcagtgcattgctgaccagtttcatcggcttcacatacaacaacaccagcag
aaccgagaccgtgcatggtggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacagggaaggggt
gggtccctggtga
>gnl|bcl2dbcds|A0A8C2MZN7_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Cricetulus griseus GN=BMF (length=570 residues).
cttttcccaggagagatggagccacctcagtgtgtggaggagctggaagatgatgtgttccagccagaggatggggagcc
agggacacaacctgggagcttgctctctgctgacctgtttgcccagagccagctggattgtcccctcagtcggcttcagc
tctttcctctcactcactgctgtggtcctgggctccggcccataagccaggaagacaaggccacccagaccctcagccca
gcctccccaagccagggtgttatgctgccttgtggggtcacagaggaaccccagagactcttttacggcaatgctggcta
caggcttcctctccctgccagtttccctgcaggcttgccccttggggagcagccccctgaagggcagtggcagcatcgag
cagaggtacagatcgccagaaagcttcagtgcattgctgaccagtttcatcggcttcacatacaacaacaccagcagaac
cgagaccgtgcatggtggcaggtcttcctcttcctgcaaaacctggccttgaacagagaagaaaacagggaaggggtggg
tccctggtga
© 1998-2022Legal notice