Dataset for CDS BMF of organism Chrysemys picta bellii

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C3P5Z9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Chrysemys picta bellii GN=BMF (length=579 residues).
atggatccccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgactttgg
actcacaggtcagcctggtgagatgacccctcctggcattttcacacagaaccaatcctacagctgtctcctggggaggt
ttcaactgttcccactcacacactgctgtggtccaggtatcaggcatgctgagcagcaggacaaggcaacccaaacactc
agtccatcctcttccactcaggatgtcatgttgccatgtggagtcactgaagagccccagagactcttctatgggaatgc
tgggtaccgtttacatgtccccccagttggctttgcattgaatccacacctccaagaggagcctcgggaaggtcaacggg
aagcacgtactgaggttcagattgcacggaagttacagtgcattgcagaccagttccacaggctccacatacagaggcat
cagcagaacagaaatcaagtgtggtggcagatccttctcttcctacataacttggccttaaatgtggaggcaaacaggaa
ccacgtaggtcagaggtga
>gnl|bcl2dbcds|A0A8C3P5Z9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Chrysemys picta bellii GN=BMF (length=579 residues).
atggatccccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgactttgg
actcacaggtcagcctggtgagatgacccctcctggcattttcacacagaaccaatcctacagctgtctcctggggaggt
ttcaactgttcccactcacacactgctgtggtccaggtatcaggcatgctgagcagcaggacaaggcaacccaaacactc
agtccatcctcttccactcaggatgtcatgttgccatgtggagtcactgaagagccccagagactcttctatgggaatgc
tgggtaccgtttacatgtccccccagttggctttgcattgaatccacacctccaagaggagcctcgggaaggtcaacggg
aagcacgtactgaggttcagattgcacggaagttacagtgcattgcagaccagttccacaggctccacatacagaggcat
cagcagaacagaaatcaagtgtggtggcagatccttctcttcctacataacttggccttaaatgtggaggcaaacaggaa
ccacgtaggtcagaggtga
© 1998-2022Legal notice