Dataset for CDS BAD of organism Chrysemys picta bellii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3IH53_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chrysemys picta bellii GN=BAD (length=492 residues).
atgcaccccttgacaccccccttctcttgcagcgcggcgcccgggcgccatgccccgtccctgagcatgtttcgcatcca
ggagttcccggacgaggtgttcccggggcgagggaaggagtcgcctcttccccccgagtcgcagcggggacacacgtccg
gctccaagcagccagacacccccacagctgaggtgcgaagccggatagggtcagaccccccatctctggagccagaagtg
caggatgagccaggtggggcattccgggcacgctcacgctcagccccccccatcctttgggctgccatgcgttacgggcg
ggaactgcgcaggatgagtgatgagtttgacgtggcgctgcaggtgctgccacgccccaagagtgcaggcacaacatccc
agctgcaccgggggaacagctggaaagaaaccctccaggcctggttgggacacagacccgcccgtgatgccccccccagg
agctccaaatga
© 1998-2022Legal notice