Dataset for CDS Unclassified of organism Chelydra serpentina

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3T5D8_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Chelydra serpentina (length=264 residues).
atgtgcccctgcgcgctgcacggcgggccccccgccgcctgcccctgcagctccgcccggcgcggggcgcgcggctccgg
ggcgcggctggtcgccgcccgcctcaagctggtcggggacgagctgcaggagcgcacggcgtggcgccgggcgagccgcc
ggcgggccgcggccgggagaagcctggccgcctgcctgtgcctgctatgcgccgcctcgcaggtggccgcgctggtctgg
ctgatccgcaagaggagctggtag
© 1998-2022Legal notice