Dataset for CDS Unclassified of organism Chelonoidis abingdonii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C0G546_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Chelonoidis abingdonii (length=258 residues).
cactgcacatgtcctctgaaaccagccgctttgcccgctagcagctccgccgggcacggggcgcgcttctccggggcgca
gctggtggcggcccgcctgaagctggtcggggatgagctgcaggagcggaccgcgtggcgcagggcgagcagcaggcggg
ctgcggccgggagaagcctggccacctacctgtgtctgctgtgcgccgcctcgcaggtggccgcgctggtctggctgatc
cgcaagaggagctggtag
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice