Dataset for CDS PMAIP1 of organism Catagonus wagneri

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3W860_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Catagonus wagneri GN=PMAIP1 (length=168 residues).
atgcctggaaggaggtctcgtaggaacactcagccgaatcctacgcgggtggccctcccgccagatcctgaagtcgagtg
tgtcattcagttcagaaggattggagacaaactgaatttccggcagaaacttctgaatctgatagccaaattccgcctag
aaacttga
© 1998-2022Legal notice