Dataset for CDS PMAIP1 of organism Cairina moschata domestica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3BLB7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Cairina moschata domestica GN=PMAIP1 (length=150 residues).
atgccgtgcaggaccctgcgcaaatctgcacaacccgcccggcaggcggtggcggagtgcgcgctggagctgcgcaggat
cggcgacaaggcggacctgcgacagcggatcctgaacctcatcgcaaagctgttctgccccaaaacgtga
© 1998-2022Legal notice