Dataset for CDS Unclassified of organism Caenorhabditis brenneri

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G0MQX1_uncEGL1-01 Putative Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis brenneri (length=1203 residues).
atgccttcaacagtttctcactcagaaaatatcaccaccgtcaactcaatctacaagaaaaacatggacttccgtccaaa
gttcgcgtttattcaagattctgatgccatgacagacggaacgtcttgcgtattcgttaagaattttggattttttgatg
actccaaatccaacaaaatcagtaagagaaacaatatcgggacccaactgaccgtcatctgcgacaactttaaaattgac
atgacgtcttccttagagttctcatcagtccacaatattagcagtacggtaacagcagtgtcttcagatttcggtgctga
ttctggatttcttgatgtatccaaaaccagcagtatcagcaacgttggccatgatataggaaccaaactggcagcaatgt
gtgatgactttgacgacaaaatcatgtcttgctcggagttttcaactacaaacgattctgatgttatagcaacaacgcct
tcttctgccctcatcgaggattctggacttcttgatgactcaaaaaccaacaacactggccacaatatcggtatgaaact
ggcaaaaatgtgcgatgactttgatgacgagatgatggctcattcgaaattctctgttgattatgacgctggtgttatca
caaacacaaaagttcccatactcgtcgaagattcaggatttttagatgacccaaaactaggctacattagccacaatatc
ggtgtcaaacaagcagtcatgtgtgataatttcgacaaggaaatgatgcatcactcggagtttgtgtctatgaatgattt
tgatgttatggcaacaacatcttcctctagatttggcaaggattctggatttttcgatgactccaagcacagcatcatca
gtaacatcggctacgacatcggtaccaaagtggctaacatgtgtgacgacttcgacgccaaacttatgtcttactcgaaa
ttttcgtctattcatggattcaacaatacgccaatgacttcttcttcatattctttggacatcatttcagattattcagt
tatcgatgactccacgtccagcaacatcagcgacattgactacgttatcggcaaacaatcggcagtattgtgcgacgact
ctgaagtcaaaacaatgtcttccacctcgagaagcttactcaagactgtttttgaacgtgcctggagagttttcggcttc
tga
© 1998-2022Legal notice