Dataset for CDS classical BH3-containing proteins of organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

21 sequence(s)

>gnl|bcl2dbcds|A0A3Q1LXZ6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Bos taurus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcacc
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A3Q1MV27_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagacctggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccacagggcccgctggccccaccggccagccctggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatat
tacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacat
cgtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A3Q1MV27_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=516 residues).
atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccaggagccggcttgggggaccttgctcccattcg
gagaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctg
ccgagaggcctcctcagctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatg
agttgtgacaaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgag
gcagtctcaggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagttta
atgcatattacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttg
cgctacatcgtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A3Q1MV27_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A3Q1NFP6_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Bos taurus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaagagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgaatgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A4W2C9A8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos indicus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgagctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacgcaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A4W2CDL0_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Bos indicus GN=PMAIP1 (length=165 residues).
atgcctggaaggagggctcgtaagagcgcccagccgagccccacgcgggtcccggcagatcctgaagttgaatgtgccat
tcagttgaggagaattggagacaaactgaatttccggcagaaacttgtgaatctgatatccaaactcctccgctcaggaa
cttga
>gnl|bcl2dbcds|A0A4W2CRW4_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Bos indicus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgccggccgcctgggtctgcgctc
gtccgccgcgcagctcacggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgtccggcgcgctccctacctactggccctggctgtgcgcggccgcgcaggtggcagcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A4W2D2G6_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Bos indicus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccgggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcctccaag
gcagcccacagggcccgctggccccaccggccagccctggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatat
tacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacat
cgtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A4W2D2G6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos indicus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccgggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A4W2EII1_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Bos indicus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggccatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
>gnl|bcl2dbcds|A0A4W2EKD9_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Bos indicus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggcggtgtcctgcggcctctgcgaacccggcctgcctgctgcccccgccgcccccgccctgc
tgcccgccgcctacctctgcgcccccaccgccccgcccgccgtcaccgccgccctgggggccccccgctggcctgggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccttcactctcgcccgcggagcagcacctggaatcacc
agtgcccagcgccccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcgg
cagcgacaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagc
ccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A4W2EKD9_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Bos indicus GN=BBC3 (length=396 residues).
gtgagagccactgcagaggctgcccgggcatgtccgtgccagctgcccggggctttcttctccccctgggtcccccacca
gattcgtggtcctcagccttcactctcgcccgcggagcagcacctggaatcaccagtgcccagcgccccgggggccctgg
cgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcgg
cggatggcggacgacctcaacgcgctatacgagcggcggagacaagaggagcggcagcgacaccgcccctcaccctggag
ggtcctgtacaatctcatcatgggactcctgccctttcccgggggccgcggagcccccgaggtggagcccaattag
>gnl|bcl2dbcds|A0A4W2G3J8_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Bos indicus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagacctggggcccccacctctttacagacagagcggcaaggtaatcctgaaggagaaggggaccgctgcccccaag
gcagcccacagggcccgctggccccaccggccagccctggccctttcgctaccagatccccgctcttcatcttcgtgaga
agatcctccttgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatat
tacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacat
cgtgcgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A4W2G3J8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos indicus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A4W2GVZ3_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Bos indicus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgccggccgcctgggtctgcgctc
gtccgccgcgcagctcacggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccctacctactggccctggctgtgcgcggccgcgcaggtggcagcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A4W2INA4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Bos indicus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggcaatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
>gnl|bcl2dbcds|F1MUT9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgagctccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacgcaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
>gnl|bcl2dbcds|Q05KI3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Bos taurus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggccatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
>gnl|bcl2dbcds|Q05KI3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Bos taurus GN=BMF (length=555 residues).
atggagccaccccagtgtgtggaggagctggaggatgacgtattccagcccgaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgc
actgctgtggccctgggcttcgacccaccagccaggaagacaaggctacccagactctcagcccagcttccccgagccag
ggtgtcatgctgccttgtggggtgactgaggagccccagcgactcttttatggccatgctggctaccggctcccccttcc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagagatacagattg
cccgaaaactccagtgcattgcagaccagttccatcggcttcatatgcagcaataccagcagaaccgaaatcgcatgtgg
tggcagatcctcctcttcctacacaacgtggctttgaatggagatgagaacaggaacggggcaggccccaggtga
>gnl|bcl2dbcds|Q3SYZ0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Bos taurus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccgtgcagataggggcctgggccccagccccac
aggggacaggcccccaggtctcagcaagcactggctaacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccggcagcagccaccatggaggcactggggctgtggagacccggagtcgtcacagctcctaccgcgcggggcca
gaggataatgaagagacggaggaggaggatctcggcccctttaggggccgctcgcgttcggcgccccccaacctctgggc
tgcacagcgatatggccgcgaactccggaggatgagcgacgagtttcacgtctccttcaaggggcttcctcgcccgaaga
gcgcgggcacggcaacggaaatgcgacaaagccccagctggacgcgcttcctccagtcctggttgagccggaacttgggg
agaggaggctccgccccctcccagtga
© 1998-2020Legal notice