Dataset for CDS Unclassified of organism Bos mutus grunniens

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9XEE3_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Bos mutus grunniens (length=438 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgccggccgcctgggtctgcgctc
gtccgccgcgcagctcacggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgccctacctactggccctggctgtgcgcggccgcgcaggtggcagcgct
ggcggcctggctgctcggcaggcggaacttgtaggaacgcggggcttcttggtggggccggagccgagacccagccggag
cgagcaacaggttggtgaaaaccctgtgtcctggagaaagctggttcctgttttcccaagggggagcccagagcttgaaa
ggccacagttggcacttcgagaaggaagtggagaataa
© 1998-2022Legal notice