Dataset for CDS BCL2L11 of organism Bos mutus grunniens

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9YZT6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagaccgggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatgggtaagcaataccggggaggcgactgt
gcatgcgtgggtgcttaa
© 1998-2022Legal notice