Dataset for CDS PMAIP1 of organism Aquila chrysaetos chrysaetos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A663FH84_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=PMAIP1 (length=162 residues).
atgcctggcaggaccctgcgcaaggccgcgccgcccgccgctcccgcagggcgggaggtggaggcgcagtgcgccctgca
gctgcgcaggatcggcgacaagtgggacctgcggcagaagatcctgaacctcctcacgaagctattcttcccggagacgt
ga
© 1998-2020Legal notice