Dataset for CDS BCL2L11 of organism Anser brachyrhynchus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9I6Q1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Anser brachyrhynchus GN=BCL2L11 (length=243 residues).
cagcgcgaggccaggcctccgtgggcacgcccagaaatatggattgcacaggagctgcggcgcattggagatgaattcaa
tgcctcctattgtccgagaagggtaattttcttatttttactttccatttctttacacttagtagggttttcaatcagca
cttctcttacctgtaaatacctaatgctaccccaaatccaacttcatttgcatcatgcaaatagcctatttcctgctgac
tga
© 1998-2022Legal notice