Dataset for CDS PMAIP1 of organism Anas platyrhynchos platyrhynchos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A493SWX7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=PMAIP1 (length=156 residues).
atgccgtgcaggaccctgcgcaaacctgcacaaccctccgcagaacggcaggcggtggcggagtgcgcgctggagctgcg
ccggatcggcgacaaggcggactttcgacagcggatcctgaacctcatcacaaagctgttctgccccaaaacgtga
© 1998-2020Legal notice