Dataset for CDS PMAIP1 of organism Amazona collaria

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8B9EVZ5_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Amazona collaria GN=PMAIP1 (length=162 residues).
atgcctggcaagacaccgcggaaagctgcggcgcccaccgctcccgcggaggcggaggtggtgtcggagtgcgccctgca
gctacgcaggataggcgacaagtggaacctgcggcagaagatcctgaacctcctcacgaagctcttctgcccggagacat
ga
© 1998-2022Legal notice