Dataset for CDS poxviridae of organism Orf virus

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F1AXH8_ORFV125-01       atggcaaacagagaagaaattgacgcctctgccgtcatggctgcctacct
A0A0F6N236_ORFV125      atggcaaacagagaagagattgacgcttccgccgtcatggctgcctacct
Q6TVX5_ORFV125-01       atggcaaacagagaagagattgacgcctccgccgtcatggctgcctacct
Q80G30_ORFV125-01       atggcaaacagagaagagattgacgcctccgccgtcatggctgcctacct
W6EVU4_ORFV125-01       atggcaaacagagaagagattgacgcctccgccgttatggctgcctacct
Q6TVJ5_ORFV125-01       atggcaaacagagacgacattgacgcctccgccgttatggctgcctacct
A0A2Z2Q9B0_ORFV125      atggcaaacagagacgacattgacgcctccgccgttatggctgcctacct
A0A1D8RAA0_ORFV125      atggcaaacagagaagagattgacgcctccgccgttatggctgcctacct
A0A2Z2QAK0_ORFV125      atggcaaacagagaagagattgacgcctccgccgtcatggctgcctacct
A0A2Z2Q5R8_ORFV125      atggcaaacagagacgacattgacgcctccgccgttatggctgcccacct
A0A2Z2Q7G3_ORFV125      atggcaaacagagacgacattgacgcctccgccgttatggctgcctacct
A0A0R8I4U2_ORFV125      atggcaaacagagacgaaattgacgcctccgccgtcatggctgcctacct
A0A0R8HLA0_ORFV125      atggcaaacagagacgacattgacgcctccgccgttatggctgcctacct
A0A0R8HV90_ORFV125      atggcaaacagagacgacattgacgcctccgccgtcatggctgcctacct
                        ************** ** ******** ** ***** ********* ****

F1AXH8_ORFV125-01       cgcgagagagtacgcggtggctgtagaggaacagctgacgccgcgcgagc
A0A0F6N236_ORFV125      cgcgagagagtacgcggcggcggtagaggaacagctgacgccgcgcgagc
Q6TVX5_ORFV125-01       cgcgagagagtacgcggcggctgtagaagaacagctgacgccgcgcgagc
Q80G30_ORFV125-01       cgcgagagagtacgcggcggctgtagaagaacagctgacgccgcgcgagc
W6EVU4_ORFV125-01       cgcgagagagtacgcggaggctgtagaggaacagctgacgccgcgcgagc
Q6TVJ5_ORFV125-01       cgcgagagagtacgcggaggctgtagaggaacagctgacgctgcgcgagc
A0A2Z2Q9B0_ORFV125      cgcgagagagtacgcggaggctgtagaggaacagctgacgccgcgcgagc
A0A1D8RAA0_ORFV125      cgcgagagagtacgcggaggctgtagaggaacagctgacgccgcgcgagc
A0A2Z2QAK0_ORFV125      cgcgagagagtacgcggaggctgtagaggaacagctgacgccgcgcgagc
A0A2Z2Q5R8_ORFV125      cgcgagagagtacgcggaggctgtagaggaacagctgacgccgcgcgagc
A0A2Z2Q7G3_ORFV125      cgcgagagagtacgcggaggctgtagaggaacagctgacgccgcgcgagc
A0A0R8I4U2_ORFV125      cgcgagagagtacgcggaggctgtagaggaacagctgacgccgcgcgagc
A0A0R8HLA0_ORFV125      cgcgagagagtacgcggaggctgtagaggaacagctgacgccgcgcgagc
A0A0R8HV90_ORFV125      cgcgagagagtacgcggaggctgtagaggaacagctgacgccgcgcgagc
                        ***************** *** ***** ************* ********

F1AXH8_ORFV125-01       gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
A0A0F6N236_ORFV125      gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
Q6TVX5_ORFV125-01       gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
Q80G30_ORFV125-01       gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
W6EVU4_ORFV125-01       gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
Q6TVJ5_ORFV125-01       gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
A0A2Z2Q9B0_ORFV125      gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
A0A1D8RAA0_ORFV125      gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
A0A2Z2QAK0_ORFV125      gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggccgccg
A0A2Z2Q5R8_ORFV125      gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
A0A2Z2Q7G3_ORFV125      gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
A0A0R8I4U2_ORFV125      gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
A0A0R8HLA0_ORFV125      gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
A0A0R8HV90_ORFV125      gcgatgcgctcgaagcccttcgcgtttccggcgaggaggtccggtcgccg
                        ******************************************** *****

F1AXH8_ORFV125-01       ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
A0A0F6N236_ORFV125      ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
Q6TVX5_ORFV125-01       ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
Q80G30_ORFV125-01       ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
W6EVU4_ORFV125-01       ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
Q6TVJ5_ORFV125-01       ctgctgcaagaactctcgaacgcgggcgagcaccgcaccaaccctgaaaa
A0A2Z2Q9B0_ORFV125      ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
A0A1D8RAA0_ORFV125      ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccctgaaaa
A0A2Z2QAK0_ORFV125      ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
A0A2Z2Q5R8_ORFV125      ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
A0A2Z2Q7G3_ORFV125      ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
A0A0R8I4U2_ORFV125      ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
A0A0R8HLA0_ORFV125      ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
A0A0R8HV90_ORFV125      ctgctgcaagaactctcgaacgcgggcgagcaccgcgccaaccccgaaaa
                        ************************************ ******* *****

F1AXH8_ORFV125-01       ctcgcacatccccgccgccctcgtctccgcgcttctcgaagcccccacct
A0A0F6N236_ORFV125      ctcgcacatccccgccgccctcgtatccgcgcttctcgaagcccccacct
Q6TVX5_ORFV125-01       ctcgcacatccccgccgccctcgtctccgcgcttctcgaagcccccactt
Q80G30_ORFV125-01       ctcgcacatccccgccgccctcgtctccgcgcttctcgaagcccccacct
W6EVU4_ORFV125-01       ctcgcacatccccgccgccctcgtctccgcgcttctcgaagcccccacct
Q6TVJ5_ORFV125-01       ctcgcacatccccgccgccctcgtctccgcgcttctcgaaacccccacat
A0A2Z2Q9B0_ORFV125      ctcgcacatccccgccgccctcgtctccgcgcttctcgaggcccctacct
A0A1D8RAA0_ORFV125      ctcgcacattcccgccgccctcgtctccgcgcttctcgaggcccccacct
A0A2Z2QAK0_ORFV125      ctcgcacatccccgccgccctcgtctccgcgcttctcgaggcccctacct
A0A2Z2Q5R8_ORFV125      ctcgcacatccccgccgccctcgtctccgcgcttctcgaagctcccacct
A0A2Z2Q7G3_ORFV125      ctcgcacatccccgccgccctcgtctccgcgcttctcgaagctcccacct
A0A0R8I4U2_ORFV125      ctcgcacatccccgccgccctcgtctccgcgcttctcgaagctcccactt
A0A0R8HLA0_ORFV125      ctcgcacatccccgccgccctcgtctccgcgcttctcgaagcccccacct
A0A0R8HV90_ORFV125      ctcgcacatccccgccgccctcgtctccgcgcttctcgaagctcccacct
                        ********* ************** **************  * ** ** *

F1AXH8_ORFV125-01       cccccggccgcatggtcactgcgattgagctctgcgcgcagatgggccgg
A0A0F6N236_ORFV125      cccccggccgcatggtcactgcgattgagctctgcgcgcagatgggccgg
Q6TVX5_ORFV125-01       cccccggccgcatggtcactgcgattgagctctgcgcgcagatgggccgg
Q80G30_ORFV125-01       cccccggccgcatggtcactgcgattgagctctgcgcgcagatgggccgg
W6EVU4_ORFV125-01       cccccggccgcatggtcactgcggttgagctctgtgcgcagatgggccgg
Q6TVJ5_ORFV125-01       cccccggccgcatggtcactgcggttgagctctgcgcgcagatgggccgg
A0A2Z2Q9B0_ORFV125      cccccggccgcgtggtcactgcggttgggctctgtgcgcagatgggccga
A0A1D8RAA0_ORFV125      cccccggccgcatggtcactgcggttgagctctgcgcgcagatgggccgg
A0A2Z2QAK0_ORFV125      cccccggccgcatggtcactgcggttgagctctgcgcgcagatgggccgg
A0A2Z2Q5R8_ORFV125      cccccggccgcatggtcactgcggttgagctctgtgcgcagatgggccgg
A0A2Z2Q7G3_ORFV125      cccccggccgcatggtcactgcggttgagctctgtgcgcagatgggccgg
A0A0R8I4U2_ORFV125      cccccggccgcatggtcactgcggttgagctctgcgcgcagatgggccga
A0A0R8HLA0_ORFV125      cccccggccgcatggtcactgcggttgagctctgcgcgcagatgggccgg
A0A0R8HV90_ORFV125      cccccggccgcatggtcaccgcggttgagctctgcgcgcagatgggccgg
                        *********** ******* *** *** ****** ************** 

F1AXH8_ORFV125-01       ctatggacgcgcggccacaagctcgttgacttcatgcggctcgtgtacgt
A0A0F6N236_ORFV125      gtatggacgcgcggccgcaagctcgtcgacttcatgcggctcgtgtacgt
Q6TVX5_ORFV125-01       gtatggacgcgcggccgccggctcgtcgacttcatgcggctcgtgtacgt
Q80G30_ORFV125-01       gtatggacgcgcggccgccagctcgtcgaattcatgcggctcgtgtacgt
W6EVU4_ORFV125-01       ctatggacgcgcggccgccagctcgttgacttcatgcggctcgtgtacgt
Q6TVJ5_ORFV125-01       ctatggacgcgcggccgccagctcgtcgacttcatgcggctcgtgtacgt
A0A2Z2Q9B0_ORFV125      ctatggacgcgcggccgccagctcgtcgacttcatgcggctcgtgtacgt
A0A1D8RAA0_ORFV125      ctatggacgcgcggccgccagctcgttgacttcatgcggctcgtgtacgt
A0A2Z2QAK0_ORFV125      ctatggacgcgcggccgccagctcgtcgacttcatgcggctcgtgtacgt
A0A2Z2Q5R8_ORFV125      ctatggacgcgcggccgccagctcgtcgacttcatgcggctcgtgtacgt
A0A2Z2Q7G3_ORFV125      ctatggacgcgcggccgccagctcgtcgacttcatgcggctcgtgtacgt
A0A0R8I4U2_ORFV125      ctatggacgcgcggccgccagctcgtcgacttcatgcggctcgtgtacgt
A0A0R8HLA0_ORFV125      ctatggacgcgcggccgccggctcgtcgacttcatgcggctcgtgtacgt
A0A0R8HV90_ORFV125      ctatggacgcgcggccgccagctcgtcgacttcatgcggctcgtgtacgt
                         *************** *  ****** ** ********************

F1AXH8_ORFV125-01       gctcctaaaccgtctgccgcccacggccgacgaggacctcagcgcctggc
A0A0F6N236_ORFV125      gctcctagaccgtctgccgcccacggctgacgaggacctcagcgcctggc
Q6TVX5_ORFV125-01       gctcctagaccgtctgccgcccacggccgacgaggacctcagcgcctggc
Q80G30_ORFV125-01       gctcctagaccgtctgccgcccacggccgacgaggacctcagcacctggc
W6EVU4_ORFV125-01       gctcctagaccgtctgccgcccacggccgacgaggacctcagcgcctggc
Q6TVJ5_ORFV125-01       gctcctagaccgtctgccgcccacagccgacgaggacctcggcgcctggc
A0A2Z2Q9B0_ORFV125      gctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
A0A1D8RAA0_ORFV125      gctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
A0A2Z2QAK0_ORFV125      gctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
A0A2Z2Q5R8_ORFV125      gctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
A0A2Z2Q7G3_ORFV125      gctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
A0A0R8I4U2_ORFV125      gctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
A0A0R8HLA0_ORFV125      gctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
A0A0R8HV90_ORFV125      gctcctagaccgtctgccgcccacggccgacgaggacctcggcgcctggc
                        ******* **************** ** ************ ** ******

F1AXH8_ORFV125-01       tgcaggccgtcgcgcgagtgcacggcacgcggcgccgcctgcaccgcgtt
A0A0F6N236_ORFV125      tgcaggccgtcgcgcgcgtacacggcacgcggcgccgcctgcaccgcgtt
Q6TVX5_ORFV125-01       tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgtt
Q80G30_ORFV125-01       tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgtt
W6EVU4_ORFV125-01       tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgtt
Q6TVJ5_ORFV125-01       tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgct
A0A2Z2Q9B0_ORFV125      tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgct
A0A1D8RAA0_ORFV125      tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgct
A0A2Z2QAK0_ORFV125      tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgct
A0A2Z2Q5R8_ORFV125      tgcaggctgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgct
A0A2Z2Q7G3_ORFV125      tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcact
A0A0R8I4U2_ORFV125      tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgct
A0A0R8HLA0_ORFV125      tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgct
A0A0R8HV90_ORFV125      tgcaggccgtcgcgcgcgtgcacggcacgcggcgccgcctgcaccgcgct
                        ******* ******** ** ***************************  *

F1AXH8_ORFV125-01       ctcggcgtcggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
A0A0F6N236_ORFV125      ctcggcgtcggggccgtcatggcaggcgtcggtatgctgctgctcggcgt
Q6TVX5_ORFV125-01       ctcggcgtcggggccgtcatggcaggcgtcggtatgctgctgctcggcgt
Q80G30_ORFV125-01       ctcggcgtcggggccgtcatggcaggcgtcggtatgctgctgctcggcgt
W6EVU4_ORFV125-01       ctcggcgtcggggctgtcatggcaggcgtcggtatgctgctgctcggcgt
Q6TVJ5_ORFV125-01       ctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
A0A2Z2Q9B0_ORFV125      ctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
A0A1D8RAA0_ORFV125      ctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
A0A2Z2QAK0_ORFV125      ctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
A0A2Z2Q5R8_ORFV125      ctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
A0A2Z2Q7G3_ORFV125      ctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
A0A0R8I4U2_ORFV125      ctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
A0A0R8HLA0_ORFV125      ctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
A0A0R8HV90_ORFV125      ctcggcgttggggccgtcgtggcaggcgtcggtatgctgctgctcggcgt
                        ******** ***** *** *******************************

F1AXH8_ORFV125-01       gcgcgtgttgcggcgcacataa
A0A0F6N236_ORFV125      gcgcgtgttgcggcgcacataa
Q6TVX5_ORFV125-01       gcgcgtgttgcggcgcacataa
Q80G30_ORFV125-01       gcgcgtgttgcggcgcacataa
W6EVU4_ORFV125-01       gcgcgtgttgcggcgcacataa
Q6TVJ5_ORFV125-01       gcgcgtgttgcggcgcacataa
A0A2Z2Q9B0_ORFV125      gcgcgtgttgcggcgcacataa
A0A1D8RAA0_ORFV125      gcgcgtgttgcggcgcacataa
A0A2Z2QAK0_ORFV125      gcgcgtgttgcggcgcacataa
A0A2Z2Q5R8_ORFV125      gcgcgtgttgcggcgcacataa
A0A2Z2Q7G3_ORFV125      gcgcgtgttgcggcgcacataa
A0A0R8I4U2_ORFV125      gcgcgtgttgcggcgcacataa
A0A0R8HLA0_ORFV125      gcgcgtgttgcggcgcacataa
A0A0R8HV90_ORFV125      gcgcgtgttgcggcgcacataa

© 1998-2020Legal notice