Dataset for CDS ORF115R of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q5GAF0_ORF115R-01      atgacgaatataaacttttcagcgttgttgagaggcgagcgcatgtgtcc
Q5YFF0_ORF115R-01      atgacgaacataaacttttcagcgttgttgagaggcgagcgcatgtgtcc
                       ******** *****************************************

Q5GAF0_ORF115R-01      tctcacgcgcgaaatacactcgcaaatgttgatcgtaacgaaatcttaca
Q5YFF0_ORF115R-01      tctcacgcgcgaaatacactcgcaaatgttgatcgtaacgaaatcttaca

Q5GAF0_ORF115R-01      gtttggtggaaacgtttcgcgctttccccagactgccaaatattttagaa
Q5YFF0_ORF115R-01      gtttggtagaaacgtttcgcgctttccccagactgccaaatattttagaa
                       ******* ******************************************

Q5GAF0_ORF115R-01      attggcaacaatatcgtttcggacggcaacttgaattgggggagaatttt
Q5YFF0_ORF115R-01      attggcaacaatatcgtttcggacggcaacttgaattgggggagaatttt

Q5GAF0_ORF115R-01      gatactgttgggcatctctcaactttactttacaaaatccgaatcggaat
Q5YFF0_ORF115R-01      gatactgttgggcatctctcaactttactttacaaaatccgaatcggaat

Q5GAF0_ORF115R-01      cggaaagaacacagataacggaacaactcgaacgatttttcaggcaagac
Q5YFF0_ORF115R-01      cggaaagaacacagataacggaacaactcgaacgatttttcaggcaagac

Q5GAF0_ORF115R-01      gcgatctcaaattggatcgcgtcaaacggaggctgggtaacgtgcgcaag
Q5YFF0_ORF115R-01      gcgatctcaaattggatcgtgtcaaacggaggctgggtaacgtgcgcaag
                       ******************* ******************************

Q5GAF0_ORF115R-01      cttggacttgagaaactactcttcggtaaccaacgctttgcaagccatgt
Q5YFF0_ORF115R-01      cttggacttgagaaactactcttcggtaaccaacgctttgcaagccatgt

Q5GAF0_ORF115R-01      gttttttcggcgctttgtttggaacaatagccgtaattgcttattatctg
Q5YFF0_ORF115R-01      gttttttcggcgctttgtttggaacaatagccgtaattgcttattatctg

Q5GAF0_ORF115R-01      ttaccatga
Q5YFF0_ORF115R-01      ttaccatga

© 1998-2020Legal notice