Dataset for CDS 097R of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

38 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

I2BFW4_097R-01          atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A7G9TL46_097R-01      atgggcgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
D3TTY2_097R-01          atgggcgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A6M8PQB5_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
Q2WEP2_097R-01          atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A0D3R3I2_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A8A4YKK4_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A192GQ13_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A3Q8UH03_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
H6WEE3_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A223PJ87_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
Q6GZM8_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A8F9RB68_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A8F9RAB0_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
W8TMV3_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2U9QGY4_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2U9QHH2_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
H9XFR8_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A220IH18_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2P1GJP0_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
C3RWV2_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A6M5K8N1_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A222NTZ1_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A1B2ITU5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0A0VDG1_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A2D0XKG8_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A223PJJ8_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0D3R3S5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A222NTN8_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
T2C510_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
V5N073_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A2D0XMC5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0U2QBA9_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0U2QHX4_097R-01      atggacgtgaggcaatttctgttagactgcgaagctcccgaggagatggt
Q6YH32_097R-01          atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0U2R7T3_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A3Q9T2R6_097R-01      atggacgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A3Q9T8U5_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
                        ****  **************** ****** ********************

I2BFW4_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A7G9TL46_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
D3TTY2_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A6M8PQB5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggccttcg
Q2WEP2_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggccttcg
A0A0D3R3I2_097R-01      ggccctgagggccgccgcggacgccgtggggatagacaacagggcctgcg
A0A8A4YKK4_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggccttcg
A0A192GQ13_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacaaggcctgcg
A0A3Q8UH03_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacaaggcctgcg
H6WEE3_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A223PJ87_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
Q6GZM8_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A8F9RB68_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A8F9RAB0_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
W8TMV3_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A2U9QGY4_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A2U9QHH2_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
H9XFR8_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A220IH18_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A2P1GJP0_097R-01      ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
C3RWV2_097R-01          ggccctgagggccgccgcggacgccgtgggagtagacaacagggcctgcg
A0A6M5K8N1_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A222NTZ1_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A1B2ITU5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A0A0VDG1_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcatgcg
A0A2D0XKG8_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcatgcg
A0A223PJJ8_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgca
A0A0D3R3S5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A222NTN8_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
T2C510_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
V5N073_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A2D0XMC5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A0U2QBA9_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
A0A0U2QHX4_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
Q6YH32_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
A0A0U2R7T3_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacatggcctgtg
A0A3Q9T2R6_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagtgcctgcg
A0A3Q9T8U5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
                        ******************************  *********  ** *   

I2BFW4_097R-01          cccacctgtacaccatgctgtgggaaggcgtcaacctggaggatgttcac
A0A7G9TL46_097R-01      cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
D3TTY2_097R-01          cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A6M8PQB5_097R-01      cccacctatacaccatgctgtgggaaggcgttaacctggaggaggttcac
Q2WEP2_097R-01          cccacctatacaccatgctgtgggaaggcgttaacctggaggaggttcac
A0A0D3R3I2_097R-01      cccacctatacaccatgctgtgggaaggtgtcaacctggaggaggttcac
A0A8A4YKK4_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A192GQ13_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A3Q8UH03_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
H6WEE3_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A223PJ87_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
Q6GZM8_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A8F9RB68_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A8F9RAB0_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
W8TMV3_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2U9QGY4_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2U9QHH2_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
H9XFR8_097R-01          cccacctatacaccatgctgtgggaaggcgtcagcctggaggaggttcac
A0A220IH18_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2P1GJP0_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
C3RWV2_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A6M5K8N1_097R-01      tccacctatacaccatgctgtgggaaggcatcaacctggaggaggttcac
A0A222NTZ1_097R-01      cccacctatacaccatgttgtgggaaggtgtcaacctggaggaggttcac
A0A1B2ITU5_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0A0VDG1_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2D0XKG8_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A223PJJ8_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0D3R3S5_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggtgcac
A0A222NTN8_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
T2C510_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
V5N073_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2D0XMC5_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0U2QBA9_097R-01      cccacctgtacaccatgctgtgggaaggcatcaacctggaggaggttcac
A0A0U2QHX4_097R-01      cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
Q6YH32_097R-01          cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0U2R7T3_097R-01      cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A3Q9T2R6_097R-01      cacacctgtacaccatgcattgggaaggcgtcaacctggaggaggttcac
A0A3Q9T8U5_097R-01      cacacctgtacaccatgcagtgggaaggcgtcaacctggaggaggttcac
                          ***** *********   ********  * * ********* ** ***

I2BFW4_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A7G9TL46_097R-01      gcatccctcctgggagacggcattgtaaactggggcagggtggccgcgtt
D3TTY2_097R-01          gcatccctcctgggagacggcattgtaaactggggcagggtggccgcgtt
A0A6M8PQB5_097R-01      gcatccctcctgagagacggcgttgtaaactggggcagggtggccgcgtt
Q2WEP2_097R-01          gcatccctcctgagagacggcgttgtaaactggggcagggtggccgcgtt
A0A0D3R3I2_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A8A4YKK4_097R-01      gcatccctcctgagagacggcgttgtaaactggggcagggtggccgcgtt
A0A192GQ13_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgtgtt
A0A3Q8UH03_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgtgtt
H6WEE3_097R-01          gcatccctcctgggagacggcgttgtaaactggggcaggatggccgcgtt
A0A223PJ87_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
Q6GZM8_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A8F9RB68_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A8F9RAB0_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
W8TMV3_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2U9QGY4_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2U9QHH2_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
H9XFR8_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A220IH18_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2P1GJP0_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
C3RWV2_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A6M5K8N1_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A222NTZ1_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A1B2ITU5_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0A0VDG1_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2D0XKG8_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A223PJJ8_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0D3R3S5_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A222NTN8_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
T2C510_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
V5N073_097R-01          gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2D0XMC5_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0U2QBA9_097R-01      gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0U2QHX4_097R-01      gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
Q6YH32_097R-01          gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A0U2R7T3_097R-01      gcatccttcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A3Q9T2R6_097R-01      gcatccctcctgggagacggcgttgtaaactggggtagggtggccgtgtt
A0A3Q9T8U5_097R-01      gcatccctcctgggagacggcgttgtaaactggggtagggtggccgtgtt
                        ****** ***** ******** ************* *** ****** ***

I2BFW4_097R-01          tatgcacgtctgcaggtataccgtcaggacctttccgtctagcatggata
A0A7G9TL46_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccatctagcatggata
D3TTY2_097R-01          tatgcacatctgcaggtacaccgtcaggacctttccatctagcatggata
A0A6M8PQB5_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
Q2WEP2_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A0D3R3I2_097R-01      tatgcacatctgcaggtacattgtcaggacctttccgtctagcatggata
A0A8A4YKK4_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A192GQ13_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A3Q8UH03_097R-01      tatgcacatctgcaggtacatcgtcaggatctttccgtccagcatggata
H6WEE3_097R-01          tatgcacatctgcagatacatcgtcaggacctttccgtctagcatggata
A0A223PJ87_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
Q6GZM8_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A8F9RB68_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A8F9RAB0_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
W8TMV3_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A2U9QGY4_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A2U9QHH2_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
H9XFR8_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A220IH18_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A2P1GJP0_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
C3RWV2_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
A0A6M5K8N1_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A222NTZ1_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A1B2ITU5_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A0A0VDG1_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A2D0XKG8_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A223PJJ8_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A0D3R3S5_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A222NTN8_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
T2C510_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
V5N073_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A2D0XMC5_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A0U2QBA9_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
A0A0U2QHX4_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
Q6YH32_097R-01          tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
A0A0U2R7T3_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
A0A3Q9T2R6_097R-01      tatgcacgtctgcaggtacaccgtcaggacctttccgtctagcatggata
A0A3Q9T8U5_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
                        ******* ******* ** *  ******* ****** ** **********

I2BFW4_097R-01          ggacagaggttgctctgactaaatttatacaggacccaagggtagacaag
A0A7G9TL46_097R-01      gggcagaggttgctctgactaaatttatacaggacccaaagatagacgag
D3TTY2_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacgag
A0A6M8PQB5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
Q2WEP2_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A0D3R3I2_097R-01      ggacagaggttgcgctaactaaatttatacaggacccaaagatagacaag
A0A8A4YKK4_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A192GQ13_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A3Q8UH03_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
H6WEE3_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A223PJ87_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
Q6GZM8_097R-01          gaacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A8F9RB68_097R-01      gaacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A8F9RAB0_097R-01      gaacagaggttgctctgactaaatttatacaggacccaaagatagacaag
W8TMV3_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2U9QGY4_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2U9QHH2_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
H9XFR8_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A220IH18_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2P1GJP0_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
C3RWV2_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A6M5K8N1_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A222NTZ1_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A1B2ITU5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A0A0VDG1_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2D0XKG8_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A223PJJ8_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A0D3R3S5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A222NTN8_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
T2C510_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
V5N073_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2D0XMC5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A0U2QBA9_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatatacaag
A0A0U2QHX4_097R-01      ggacagaggttgctttgactaaatttatacaggacccaaagatatacaag
Q6YH32_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatatacaag
A0A0U2R7T3_097R-01      ggacagaggttgctttgactaaatttatacaggacccaaagatatacaag
A0A3Q9T2R6_097R-01      ggacagaggttgcgctgactaaatttatacaggacccaaaaatatacaag
A0A3Q9T8U5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatatacaag
                        *  **********  * **********************   ** ** **

I2BFW4_097R-01          cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A7G9TL46_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
D3TTY2_097R-01          cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A6M8PQB5_097R-01      caactcagagagtggacagataggctgggtacagttggggtgattgggaa
Q2WEP2_097R-01          caactcagagagtggacagataggctgggtacagttggggtgattgggaa
A0A0D3R3I2_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A8A4YKK4_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A192GQ13_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A3Q8UH03_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
H6WEE3_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A223PJ87_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
Q6GZM8_097R-01          caactcagagagtggacagataggctgggtacagtcgggctgattgggag
A0A8F9RB68_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A8F9RAB0_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
W8TMV3_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2U9QGY4_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2U9QHH2_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
H9XFR8_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A220IH18_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2P1GJP0_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
C3RWV2_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A6M5K8N1_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A222NTZ1_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A1B2ITU5_097R-01      caactcagagagtggacagatagactgggtacagtcggggtgattgggag
A0A0A0VDG1_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2D0XKG8_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A223PJJ8_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A0D3R3S5_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A222NTN8_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
T2C510_097R-01          caactcagagagtggacagataggctgggtacagtcagggtgattgggag
V5N073_097R-01          caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A2D0XMC5_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
A0A0U2QBA9_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A0U2QHX4_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
Q6YH32_097R-01          cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A0U2R7T3_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A3Q9T2R6_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A3Q9T8U5_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
                        ** ******************** ***********  ** ********* 

I2BFW4_097R-01          atgcttagagtggttggagcgggagtggttgggag---------------
A0A7G9TL46_097R-01      atgctta---------------gagtggttgggag---------------
D3TTY2_097R-01          atgctta---------------gagtggttgggag---------------
A0A6M8PQB5_097R-01      atgctta---------------gagtggttgggag---------------
Q2WEP2_097R-01          atgctta---------------gagtggttgggagcgggagtgataacgg
A0A0D3R3I2_097R-01      atgctta---------------gagtggttgggag---------------
A0A8A4YKK4_097R-01      atgctta---------------gcgtggttgggag---------------
A0A192GQ13_097R-01      atgctta---------------gagtggttgggag---------------
A0A3Q8UH03_097R-01      atgctta---------------gagtggttgggag---------------
H6WEE3_097R-01          atgctta---------------gagtggttgggag---------------
A0A223PJ87_097R-01      atgctta---------------gagtggttgggag---------------
Q6GZM8_097R-01          atgctta---------------gagtggttgggag---------------
A0A8F9RB68_097R-01      atgctta---------------gagtggttgggag---------------
A0A8F9RAB0_097R-01      atgctta---------------gagtggttgggag---------------
W8TMV3_097R-01          atgctta---------------gagtggttgggag---------------
A0A2U9QGY4_097R-01      atgctta---------------gagtggttgggag---------------
A0A2U9QHH2_097R-01      atgctta---------------gagtggttgggag---------------
H9XFR8_097R-01          atgctta---------------gagtggttgggag---------------
A0A220IH18_097R-01      atgctta---------------gagtggttgggag---------------
A0A2P1GJP0_097R-01      atgctta---------------gagtggttgggag---------------
C3RWV2_097R-01          atgctta---------------gagtggttgggag---------------
A0A6M5K8N1_097R-01      atgctta---------------gagtggttgggag---------------
A0A222NTZ1_097R-01      atgctta---------------gagtggttgggag---------------
A0A1B2ITU5_097R-01      atgctta---------------gagtggttgggag---------------
A0A0A0VDG1_097R-01      atgctta---------------gagtggttgggag---------------
A0A2D0XKG8_097R-01      atgctta---------------gagtggttgggag---------------
A0A223PJJ8_097R-01      atgctta---------------gagtggttgggag---------------
A0A0D3R3S5_097R-01      atgctta---------------gagtggttgggag---------------
A0A222NTN8_097R-01      atgctta---------------gagtggttgggag---------------
T2C510_097R-01          atgctta---------------gagtggttgggag---------------
V5N073_097R-01          atgctta---------------gagtggttgggag---------------
A0A2D0XMC5_097R-01      atgctta---------------gagtggttgggag---------------
A0A0U2QBA9_097R-01      atgctta---------------aaatggttgggag---------------
A0A0U2QHX4_097R-01      atgctta---------------aagtggttgggag---------------
Q6YH32_097R-01          atgctta---------------aagtggttgggag---------------
A0A0U2R7T3_097R-01      atgctta---------------aagtggttgggag---------------
A0A3Q9T2R6_097R-01      atgctta---------------gagtggttgggag---------------
A0A3Q9T8U5_097R-01      atgctta---------------gagtggttgggag---------------
                        *******                  **********               

I2BFW4_097R-01          ---------tg------------ggagtgatcactggagtgatcactgga
A0A7G9TL46_097R-01      ---------cg------------------------ggagtgatcactgga
D3TTY2_097R-01          ---------cg------------------------ggagtgatcactgga
A0A6M8PQB5_097R-01      ---------cg------------ggagtgataacgggagtgataacggga
Q2WEP2_097R-01          gagtgataacg------------ggagtgataacgggagtgataacggga
A0A0D3R3I2_097R-01      ---------tg------------------------ggagtgatcactgga
A0A8A4YKK4_097R-01      ---------cg------------ggagtgatcacgggagtgatcactgga
A0A192GQ13_097R-01      ---------cg------------ggagcgatcgcgggagtgatcgctgga
A0A3Q8UH03_097R-01      ---------cg------------ggagcgatcgcgggagtgatcgctgga
H6WEE3_097R-01          ---------cg------------------------ggagtgatcactgga
A0A223PJ87_097R-01      ---------cg------------------------ggagtgatcactgga
Q6GZM8_097R-01          ---------cg------------------------ggagtgatcactgga
A0A8F9RB68_097R-01      ---------cg------------------------ggagtgatcactgga
A0A8F9RAB0_097R-01      ---------cg------------------------ggagtgatcactgga
W8TMV3_097R-01          ---------cg------------------------ggagtgatcactgga
A0A2U9QGY4_097R-01      ---------cg------------------------ggagtgatcactgga
A0A2U9QHH2_097R-01      ---------cg------------------------ggagtgatcactgga
H9XFR8_097R-01          ---------cg------------------------ggagtgatcactgga
A0A220IH18_097R-01      ---------cg------------------------ggagtgatcactgga
A0A2P1GJP0_097R-01      ---------cg------------------------ggagtgatcactgga
C3RWV2_097R-01          ---------cg------------------------ggagtgatcactgga
A0A6M5K8N1_097R-01      ---------cg------------------------ggagtgatcactgga
A0A222NTZ1_097R-01      ---------cg------------------------ggagtgatcactgga
A0A1B2ITU5_097R-01      ---------cg------------------------ggagtgatcactgga
A0A0A0VDG1_097R-01      ---------cgggagtgatcactggagtgatcactggagtgatcactgga
A0A2D0XKG8_097R-01      ---------cg------------ggagtgatcactggagtgatcactgga
A0A223PJJ8_097R-01      ---------cg------------------------ggagtgatcactgga
A0A0D3R3S5_097R-01      ---------cg------------ggagtgatcactggagtgatcactgga
A0A222NTN8_097R-01      ---------cg------------ggagtgatcactggagtgatcactgga
T2C510_097R-01          ---------cg------------------------ggagtgatcactgga
V5N073_097R-01          ---------cg------------------------ggagtgatcactgga
A0A2D0XMC5_097R-01      ---------cg------------ggagtgatcactggagtgatcactgga
A0A0U2QBA9_097R-01      ---------cg------------------------ggagtgatcactgga
A0A0U2QHX4_097R-01      ---------cg------------------------ggagtgatcactgga
Q6YH32_097R-01          ---------cg------------------------ggagtgatcactgga
A0A0U2R7T3_097R-01      ---------cg------------------------ggagtgatcactgga
A0A3Q9T2R6_097R-01      ---------cg------------------------ggagtgatcactgga
A0A3Q9T8U5_097R-01      ---------cg------------------------ggagtgatcactgga
                                  *                        ********  * ***

I2BFW4_097R-01          gtgg------------------------------tcctgtctctcttgtt
A0A7G9TL46_097R-01      gtgg------------------------------tcctgtctctcttgtt
D3TTY2_097R-01          gtgg------------------------------tcctgtctctcttgtt
A0A6M8PQB5_097R-01      gtga------------------------------tcctgtctctcttgtt
Q2WEP2_097R-01          gtga------------------------------tcctgtctctcttgtt
A0A0D3R3I2_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A8A4YKK4_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A192GQ13_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A3Q8UH03_097R-01      gtgg------------------------------tcctgtctctcttgtt
H6WEE3_097R-01          gtgg------------------------------tcctgtctctcttgtt
A0A223PJ87_097R-01      gtgg------------------------------tcctatctctcttgtt
Q6GZM8_097R-01          gtgg------------------------------tcctatctctcttgtt
A0A8F9RB68_097R-01      gtgg------------------------------tcctatctctcttgtt
A0A8F9RAB0_097R-01      gtgg------------------------------tcctatctctcttgtt
W8TMV3_097R-01          gtgg------------------------------tcctatctctcttgtt
A0A2U9QGY4_097R-01      gtgg------------------------------tcctatctctcttgtt
A0A2U9QHH2_097R-01      gtgg------------------------------tcctatctctcttgtt
H9XFR8_097R-01          gtgg------------------------------tcctgtctctcttgtt
A0A220IH18_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A2P1GJP0_097R-01      gtgg------------------------------tcctgtctctcttgtt
C3RWV2_097R-01          gtgg------------------------------tcctgtctctcttgtt
A0A6M5K8N1_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A222NTZ1_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A1B2ITU5_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A0A0VDG1_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A2D0XKG8_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A223PJJ8_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A0D3R3S5_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A222NTN8_097R-01      gtgg------------------------------tcctgtctctcttgtt
T2C510_097R-01          gtgg------------------------------tcctgtctctcttgtt
V5N073_097R-01          gtgg------------------------------tcctgtctctcttgtt
A0A2D0XMC5_097R-01      gtgg------------------------------tcctgtctctcttgtt
A0A0U2QBA9_097R-01      gtgg------------------------------tcctgtctcttttgtt
A0A0U2QHX4_097R-01      gtgg------------------------------tcctgtctcttttgtt
Q6YH32_097R-01          gtgg------------------------------tcctgtctcttttgtt
A0A0U2R7T3_097R-01      gtgg------------------------------tcctgtctcttttgtt
A0A3Q9T2R6_097R-01      gtgatcactggagtggtcctgtctctcctgtctctcctgtctctcttgtt
A0A3Q9T8U5_097R-01      gtgatcactggagtgg------------------tcctgtctctcttgtt
                        ***                               **** ***** *****

I2BFW4_097R-01          ctcttga
A0A7G9TL46_097R-01      ctcttga
D3TTY2_097R-01          ctcttga
A0A6M8PQB5_097R-01      ctcttga
Q2WEP2_097R-01          ctcttga
A0A0D3R3I2_097R-01      ctcttga
A0A8A4YKK4_097R-01      ctcttga
A0A192GQ13_097R-01      ctcttga
A0A3Q8UH03_097R-01      ctcttga
H6WEE3_097R-01          ctcttga
A0A223PJ87_097R-01      ctattga
Q6GZM8_097R-01          ctattga
A0A8F9RB68_097R-01      ctattga
A0A8F9RAB0_097R-01      ctattga
W8TMV3_097R-01          ctattga
A0A2U9QGY4_097R-01      ctattga
A0A2U9QHH2_097R-01      ctattga
H9XFR8_097R-01          ctattga
A0A220IH18_097R-01      ctcttga
A0A2P1GJP0_097R-01      ctattga
C3RWV2_097R-01          ctattga
A0A6M5K8N1_097R-01      ctcttga
A0A222NTZ1_097R-01      ctcttga
A0A1B2ITU5_097R-01      ctcttga
A0A0A0VDG1_097R-01      ctcttga
A0A2D0XKG8_097R-01      ctcttga
A0A223PJJ8_097R-01      ctcttga
A0A0D3R3S5_097R-01      ctcttga
A0A222NTN8_097R-01      ctcttga
T2C510_097R-01          ctcttga
V5N073_097R-01          ctcttga
A0A2D0XMC5_097R-01      ctcttga
A0A0U2QBA9_097R-01      ctcttga
A0A0U2QHX4_097R-01      ctcttga
Q6YH32_097R-01          ctcttga
A0A0U2R7T3_097R-01      ctcttga
A0A3Q9T2R6_097R-01      ctcttga
A0A3Q9T8U5_097R-01      ctcttga
                        ** ****

© 1998-2022Legal notice