Dataset for CDS 097R of organism Rana tigrina ranavirus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6M8PQB5_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
Q2WEP2_097R-01          atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
                        **************************************************

A0A6M8PQB5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggccttcg
Q2WEP2_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggccttcg
                        **************************************************

A0A6M8PQB5_097R-01      cccacctatacaccatgctgtgggaaggcgttaacctggaggaggttcac
Q2WEP2_097R-01          cccacctatacaccatgctgtgggaaggcgttaacctggaggaggttcac
                        **************************************************

A0A6M8PQB5_097R-01      gcatccctcctgagagacggcgttgtaaactggggcagggtggccgcgtt
Q2WEP2_097R-01          gcatccctcctgagagacggcgttgtaaactggggcagggtggccgcgtt
                        **************************************************

A0A6M8PQB5_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
Q2WEP2_097R-01          tatgcacatctgcaggtacatcgtcaggacctttccgtccagcatggata
                        **************************************************

A0A6M8PQB5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
Q2WEP2_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
                        **************************************************

A0A6M8PQB5_097R-01      caactcagagagtggacagataggctgggtacagttggggtgattgggaa
Q2WEP2_097R-01          caactcagagagtggacagataggctgggtacagttggggtgattgggaa
                        **************************************************

A0A6M8PQB5_097R-01      atgcttagagtggttgggag------------------------cgggag
Q2WEP2_097R-01          atgcttagagtggttgggagcgggagtgataacgggagtgataacgggag
                        ********************                        ******

A0A6M8PQB5_097R-01      tgataacgggagtgataacgggagtgatcctgtctctcttgttctcttga
Q2WEP2_097R-01          tgataacgggagtgataacgggagtgatcctgtctctcttgttctcttga
                        **************************************************

© 1998-2021Legal notice