Dataset for CDS vNR13 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H3ALX7_vNR13-01      atgtgcgattcgttgaaagaggaaacccgactcttggctaacgatttcat
Q90343_vNR13-01      atgccgggctctctgaaggaggagacggcgctgctgctggaggattactt
Q9DH00_vNR13-01      atggctgactccctgaaggaagaaacggcgttgctgctggaggattactt
                     ***   *  **  **** ** ** **     *  **    * **** * *

H3ALX7_vNR13-01      ccagttttgcctcggcagcggccggactgcc-cccaaccctgcagcccgg
Q90343_vNR13-01      ccagcaccgggccggcgg-ggccgcgctgcctcccagcgccacggcggcc
Q9DH00_vNR13-01      ccagcactgctgcggcaa-ggaagggccgccgccgagtcctacggcggca
                     ****    *   ****   **  *  * *** ** *   *  * **    

H3ALX7_vNR13-01      gtcctgcgcagggtgacagcggaactggagcggcagaaccaggcgctctt
Q90343_vNR13-01      gagctgcggcgggcggcggccgagctggagcgacgggagcggcccttctt
Q9DH00_vNR13-01      gagctgcggcgagcggcggccgagctggagcggcgagagaggcccttctt
                     *  *****  * * * * ** ** ******** *   *   * *  ****

H3ALX7_vNR13-01      cgactcgtttcaggggaactgtgggccggaggccgagctcgg--------
Q90343_vNR13-01      ccgatcct-----gcgctccgctggcgcgggccgagccgcgggaggcggc
Q9DH00_vNR13-01      tcgctcct-----gcgcgccgttagcgagcggcggcacgcaggcagcgtt
                         ** *     * *  * *   **  * * *    * * *        

H3ALX7_vNR13-01      ctcggtgctgaagagggtggctgagcagctggaggccgaaggcggcttga
Q90343_vNR13-01      ggcgctgctgcggaaggtggcggcgcagctggagaccgacggcggcctga
Q9DH00_vNR13-01      gtcggcgctgcaaagtgtggtgtctgaattgaactccggaagcggcttca
                       **  ****   *  ****      *  ** *  ***   ***** * *

H3ALX7_vNR13-01      actgggggagggtggtgagtttatttgccttcgcgggctgcttggctaaa
Q90343_vNR13-01      actggggccggctgctggcgctcgtggtgttcgccggcacgttggcggca
Q9DH00_vNR13-01      actggggtcgatgcctggcgaccatagtcctcggcggctcgctggcaacg
                     *******  *     **       * *   ***  ***    ****    

H3ALX7_vNR13-01      ggggtccagcgggcccagaatgaggagtgtgcgatgggagcctgctgtgg
Q90343_vNR13-01      g------cgctggccgagagc---gcctgcgaggaagggccgagccgc--
Q9DH00_vNR13-01      g------cgctgtacgaaaac---ggctgtgaggaagggccaagccgc--
                     *       ** *  * * *     *  ** * *   **  *  ** *   

H3ALX7_vNR13-01      gaagttggctgaagctctggttaactacctggccaaggaaagaggggact
Q90343_vNR13-01      ----ctggccgccgcgctgaccgcgtacctggccgaggagcagggagagt
Q9DH00_vNR13-01      ----ttggccgcagcgctggccgcgtacctggccgaagagcagggcgagt
                          **** *  ** ***      ********* * **    ** ** *

H3ALX7_vNR13-01      ggctggaggagaatggaggctgggatggattctacaaattttttgaaaga
Q90343_vNR13-01      ggatggaggagcacggcggatgggatggcttctgtcgcttcttcggcaga
Q9DH00_vNR13-01      ggttgcgggagcacggcggatg----------------------ggtaag
                     ** **  **** * ** ** **                      *  *  

H3ALX7_vNR13-01      agtgatcattaccagg-----------agtccactgtacgaaatgcttta
Q90343_vNR13-01      catggctcccaaccagctgaccagaacagtaccttaag--caatgctatc
Q9DH00_vNR13-01      cacggc-----acgggcgggcatgagcggctcgtttgggtcgccggtgtc
                        *        *  *            *  *  *         * * * 

H3ALX7_vNR13-01      atggcagcagctgggtttggaatagcaggtttagccttcctgttagctgt
Q90343_vNR13-01      atggcagcagcagggtttggaatagcaggattagcttttctcttggtggt
Q9DH00_vNR13-01      -tgccagaagcgagg--------agca------------ccgtgcgcggc
                      ** *** ***  **        ****            *  *  *  * 

H3ALX7_vNR13-01      gc-gataa
Q90343_vNR13-01      gc-ggtag
Q9DH00_vNR13-01      gctggtag
                     ** * ** 

© 1998-2020Legal notice