Dataset for CDS vNR13 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


H3ALX7_vNR13-01         atgtgcgattcgttgaaagaggaaacccgactcttggctaacgatttcat
Q9DH00_vNR13-01         atggctgactccctgaaggaagaaacggcgttgctgctggaggattactt
Q9DH00_vNR13-02         atggctgactccctgaaggaagaaacggcgttgctgctggaggattactt
A0A670KGT8_vNR13-0      atgccgggcgcgctgcgcgaggagacggtgcagctgatggccgactactt
A0A674KEW6_vNR13-0      atgccgggctcgctgaaggagcagacggcgctgctgctgggcgattactt
Q90343_vNR13-01         atgccgggctctctgaaggaggagacggcgctgctgctggaggattactt
A0A3L8SM77_vNR13-0      atgccgcgctcgctgaaggaggagacggcgctgctgctggaggattactt
A0A674GY73_vNR13-0      atgccgcgctcgctgaaggaggagacggcgctgctgctggaggattactt
A0A663ECE3_vNR13-0      atgccgagctcgctgaaggaggagacggcgctgctgctggaggactactt
A0A672TYX3_vNR13-0      atgccgagctcgctgaaggaggagacggcgctgctgctggaggactactt
                        ***       *  **   **  * **        **      ** * * *

H3ALX7_vNR13-01         ccagttttgcctcggcag-----------cggccggact---gcc-ccca
Q9DH00_vNR13-01         ccagcactgctgcggcaa------------ggaagggcc---gccgccga
Q9DH00_vNR13-02         ccagcactgctgcggcaa------------ggaagggcc---gccgccga
A0A670KGT8_vNR13-0      gcagcaccggctcggcggcggcgggggcgccgcggcgct---gccgccca
A0A674KEW6_vNR13-0      ccagcaccgcctgggggg------------cccggcgctgccgccgccca
Q90343_vNR13-01         ccagcaccgggccggcgg------------ggccgcgct---gcctccca
A0A3L8SM77_vNR13-0      ccagcaccgcagcggcag------------cgccgcgct---gcccccca
A0A674GY73_vNR13-0      ccagcaccgcagcggcag------------cgccgcgct---gcccccca
A0A663ECE3_vNR13-0      ccagcaccggggcggcgg------------cgccgcgct---gcccccca
A0A672TYX3_vNR13-0      ccagcaccgccgcggcgg------------cagcgcgct---gcccccca
                         ***    *    **                   *  *    *** ** *

H3ALX7_vNR13-01         accctgcagcccgggtcctgcgcagggtgacagcggaactggagcggcag
Q9DH00_vNR13-01         gtcctacggcggcagagctgcggcgagcggcggccgagctggagcggcga
Q9DH00_vNR13-02         gtcctacggcggcagagctgcggcgagcggcggccgagctggagcggcga
A0A670KGT8_vNR13-0      gccgcacggccgagacgctgcggcgggtggccgacgagctggagagccgc
A0A674KEW6_vNR13-0      gccccgcggccgagacgctgcggcgggcggccagcgagctggagagccgg
Q90343_vNR13-01         gcgccacggcggccgagctgcggcgggcggcggccgagctggagcgacgg
A0A3L8SM77_vNR13-0      gccccacggcggccgcgctgcggcgggcggcggccgagctggagcggcag
A0A674GY73_vNR13-0      gccccacggcggccgtgctgcggcgggcggcggccgagctggagcggcag
A0A663ECE3_vNR13-0      gccccacggcggccacgctgcggcgggcggcggccgagctggagcggcgg
A0A672TYX3_vNR13-0      gccccacggcggccacgctgcggcgggcggcggccgagctggagcggcag
                              * **       *****  * * * *    ** ****** * *  

H3ALX7_vNR13-01         aaccaggcgctcttcg---actcgtttcaggggaactgtgggccg-----
Q9DH00_vNR13-01         gagaggcccttctttc---gctc------------ctgcgcgccg-----
Q9DH00_vNR13-02         gagaggcccttctttc---gctc------------ctgcgcgccg-----
A0A670KGT8_vNR13-0      gagcggcccttcttccgcagcgc------------ctgcacggcggccgc
A0A674KEW6_vNR13-0      gagcggcccttcttcc---gcgc------------ctgccgcccg-----
Q90343_vNR13-01         gagcggcccttcttcc---gatc------------ctgcgctccg-----
A0A3L8SM77_vNR13-0      gagcggcccttcttcc---gctc------------ctgcgcgccg-----
A0A674GY73_vNR13-0      gagcggcccttcttcc---gctc------------ctgcgcgccg-----
A0A663ECE3_vNR13-0      gagcggcccttcttcc---gctc------------ctgcgcgccg-----
A0A672TYX3_vNR13-0      gagcgggtcttcttcc---gctc------------ctgcgcgccg-----
                         *   *    ****        *            ***     **     

H3ALX7_vNR13-01         -------gaggccgagct--------cggc-tcggtgctgaagagggtgg
Q9DH00_vNR13-01         -ttagcgagcggcggcacgcaggcagcgttgtcggcgctgcaaagtgtgg
Q9DH00_vNR13-02         -ttagcgagcggcggcacgcaggcagcgttgtcggcgctgcaaagtgtgg
A0A670KGT8_vNR13-0      cttgccgcag---gagccgggcgaggcggccgcgctgctgggccgggtgg
A0A674KEW6_vNR13-0      -ctggccctggacgagcgccgggagccggcggcgctgctgagccgggtgg
Q90343_vNR13-01         -ctggcgcgggccgagccgcgggaggcggcggcgctgctgcggaaggtgg
A0A3L8SM77_vNR13-0      -ctggcgcgggccgagccgcgggaggcggccgcgctgctgggcagggtgg
A0A674GY73_vNR13-0      -ctggcgcgggccgagccgcgggaggcggccgcgctgctgggcagggtgg
A0A663ECE3_vNR13-0      -ctggcgcgggccgagccgcgggaggcggcggcgctgctggagcgggtgg
A0A672TYX3_vNR13-0      -ctggcgcgggccgagccgcaggaggcgacggcgctgctggggcgggtgg
                                     *            **    **  ****      ****

H3ALX7_vNR13-01         ctgagcagctggaggccgaaggcggcttgaactgggggagggtggtgagt
Q9DH00_vNR13-01         tgtctgaattgaactccggaagcggcttcaactggggtcgatgcctggcg
Q9DH00_vNR13-02         tgtctgaattgaactccggaagcggcttcaactggggtcgatgcctggcg
A0A670KGT8_vNR13-0      cggcgcagatggaagccgagggcggcctcaactggggccgggtggtggcg
A0A674KEW6_vNR13-0      cggagcagctggaggcggagggcggcctgaactggggccgagtgctggcg
Q90343_vNR13-01         cggcgcagctggagaccgacggcggcctgaactggggccggctgctggcg
A0A3L8SM77_vNR13-0      cggcgcagctggaggccgacggcggcctcaactggggccggctgctggcg
A0A674GY73_vNR13-0      cggcgcagctggaggcggacggcggcctcaactggggccggctgctggcg
A0A663ECE3_vNR13-0      cggcgcagctggaggccgagggcggcctcaactggggccggctgctggcg
A0A672TYX3_vNR13-0      cggtgcagctggaggctgacggcggcctcaattggggccggctgctggcg
                              *  ** *  * *   ***** * ** *****  *     **   

H3ALX7_vNR13-01         ttatttgccttcgcgggctgcttggctaaaggggtccagcgggcccagaa
Q9DH00_vNR13-01         accatagtcctcggcggctcgctggc------aacggcgctgtacgaaa-
Q9DH00_vNR13-02         accatagtcctcggcggctcgctggc------aacggcgctgtacgaaa-
A0A670KGT8_vNR13-0      ctggtcgtgttcgccggcaacttggc------ggcggcgctggccgagc-
A0A674KEW6_vNR13-0      ctggtggtgttcgcggggagcctggc------ggcggcgctggccgagc-
Q90343_vNR13-01         ctcgtggtgttcgccggcacgttggc------ggcagcgctggccgaga-
A0A3L8SM77_vNR13-0      ctcgtggtgttcgccggcacgctggc------ggccgcgctggccgagc-
A0A674GY73_vNR13-0      ctcgtggtgttcgccggcacgctggc------ggccgcgctggccgagc-
A0A663ECE3_vNR13-0      ctggtggtcttcgccggcacgctggc------cgccgcgctgaccgagc-
A0A672TYX3_vNR13-0      ctcgtggtgttcgccggcacgctggc------ggccgcgctggacgagc-
                            * *   ***  **     ****            ** *  * *   

H3ALX7_vNR13-01         tgaggagtgtgcgatgggagcctgctgtgggaagttggctgaagctctgg
Q9DH00_vNR13-01         --acggctgtgaggaagggccaagccgc------ttggccgcagcgctgg
Q9DH00_vNR13-02         --acggctgtgaggaagggccaagccgc------ttggccgcagcgctgg
A0A670KGT8_vNR13-0      --gcggcgctcgcgaccagacggccgct------ctggcggaggcgctgg
A0A674KEW6_vNR13-0      --agggcagccgggaggaggcgggccgc------ttggccgaggtgctgg
Q90343_vNR13-01         --gcgcctgcgaggaagggccgagccgc------ctggccgccgcgctga
A0A3L8SM77_vNR13-0      --ggggctgcagcgacgggccgcgctgc------ctggccgcgcacctgg
A0A674GY73_vNR13-0      --ggggctgcagcgacgggccgcgctgc------ctggccgcgcacctgg
A0A663ECE3_vNR13-0      --ggggctgcggcgacgggccgcgctgc------ctggccgccgcgctgg
A0A672TYX3_vNR13-0      --ggggctgcgccgacgggccgcgctgc------ctggccgccgcgctgg
                            *               *   *          **** *     *** 

H3ALX7_vNR13-01         ttaactacctggccaaggaaagaggggactggctggaggagaatggaggc
Q9DH00_vNR13-01         ccgcgtacctggccgaagagcagggcgagtggttgcgggagcacggcgga
Q9DH00_vNR13-02         ccgcgtacctggccgaagagcagggcgagtggttgcgggagcacggcgga
A0A670KGT8_vNR13-0      ccgcctacttggccggggagaagcgagagtggctggaggcgcacggcggc
A0A674KEW6_vNR13-0      cctcctacctggccgaggagaagcgcgagtggctggaggcgcacggcggc
Q90343_vNR13-01         ccgcgtacctggccgaggagcagggagagtggatggaggagcacggcgga
A0A3L8SM77_vNR13-0      ccgcctacctggccgaggagcgcggcgagtggctggaggcgcacggcgga
A0A674GY73_vNR13-0      ccgcgtacctggccgaggagcgcggcgagtggctggaggcgcacggcgga
A0A663ECE3_vNR13-0      ccgcctacctggccgaggagcggggcgagtggctggaggcgcacggcgga
A0A672TYX3_vNR13-0      ccgcctacctggccgaggagcgcggcgagtggctggaggcgcacggcgga
                             *** *****   **     * ** *** **  ** * * ** ** 

H3ALX7_vNR13-01         tggg-----atggattctacaaattttttgaaagaagtgatca-------
Q9DH00_vNR13-01         tggg-----acggattctgtcgcttcttcgcccgttttggtcctgggctg
Q9DH00_vNR13-02         tgggtaagcacgg----------------------------cacgggcgg
A0A670KGT8_vNR13-0      tggg-----atggcttctatcacttcttcaacaaacatggctcggatgca
A0A674KEW6_vNR13-0      tggg-----atggcttctgtcatttcttcaatggacatggctctcaacca
Q90343_vNR13-01         tggg-----atggcttctgtcgcttcttcggcagacatggctcccaacca
A0A3L8SM77_vNR13-0      tggg-----atggcttctgtcgcttctttggcagacacggctccgaggcg
A0A674GY73_vNR13-0      tggg-----atggcttctgtcgcttctttggcagacacggctcggaggcg
A0A663ECE3_vNR13-0      tggg-----atggcttctgtcgcttcttcggcagacatggctcccagccg
A0A672TYX3_vNR13-0      tggg-----atggcttctgccgcttcttcagtagacagggctccgagaca
                        ****     * **                                     

H3ALX7_vNR13-01         --ttaccaggagtccactgtacgaaatgctttaatggca---g-cagctg
Q9DH00_vNR13-01         ggagaggcgagtcaaaccttccctcttggtctcatcgtcgctg-cagccg
Q9DH00_vNR13-02         gcatgagcgg----------ctcgtttgg----gtcgccggtgtctgcca
A0A670KGT8_vNR13-0      gctgaccagaacagtaccataagcaatgctataatggcg---g-cagctg
A0A674KEW6_vNR13-0      actgaccagaacagtaccataagcagtgctatcatggca---g-cagcag
Q90343_vNR13-01         gctgaccagaacagtaccttaagcaatgctatcatggca---g-cagcag
A0A3L8SM77_vNR13-0      gccgagcagagcagcaccatcggcaatgccatcatggcagcgg-cggcgg
A0A674GY73_vNR13-0      gccgagcagagcagcaccatcggcaatgccatcatggcagcgg-cggcgg
A0A663ECE3_vNR13-0      gctgaccagagcagtaccataagcaatgccatcatggct---g-cggcgg
A0A672TYX3_vNR13-0      gctgagcagagcagtaccataagcaacgcgatcatggcc---g-cagcag
                                *                  *      * *     * * **  

H3ALX7_vNR13-01         ggtttggaatagcaggtttagccttcctgttagctgtgcgataa------
Q9DH00_vNR13-01         ga--------atcg-ggataacggttctcatcgtcgtgtggcaattccaa
Q9DH00_vNR13-02         ga--------agcgaggagcaccgtgcgcggcgctg-gtag---------
A0A670KGT8_vNR13-0      gctttggcttggctggcttggccttcctcctggcggtgcgataa------
A0A674KEW6_vNR13-0      ggtttggactagcaggattagctgttctcttggctgtacgatag------
Q90343_vNR13-01         ggtttggaatagcaggattagcttttctcttggtggtgcggtag------
A0A3L8SM77_vNR13-0      gcatcggcatggcaggattggctttcctct---tggtgcggtag------
A0A674GY73_vNR13-0      gcatcggcatggcaggattggctttcctct---tggtgcggtag------
A0A663ECE3_vNR13-0      ggtttggaatagcaggattggcttttctcttggtggtgcggtag------
A0A672TYX3_vNR13-0      gatttggaatagcaggattggcttttctcttggtggtgcggtag------
                        *           *  *     *  * *        *              

H3ALX7_vNR13-01         ------
Q9DH00_vNR13-01         tcctaa
Q9DH00_vNR13-02         ------
A0A670KGT8_vNR13-0      ------
A0A674KEW6_vNR13-0      ------
Q90343_vNR13-01         ------
A0A3L8SM77_vNR13-0      ------
A0A674GY73_vNR13-0      ------
A0A663ECE3_vNR13-0      ------
A0A672TYX3_vNR13-0      ------
                              

© 1998-2022Legal notice