Dataset for CDS herpesviridae of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

163 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P90504_ORF16-01         --------------------------------------------------
F5HGJ3_ORF16-01         --------------------------------------------------
Q76RI8_ORF16-01         --------------------------------------------------
Q99F66_BALF1-01         --------------------------------------------------
A0A4D6QN24_BALF1-0      --------------------------------------------------
A0A385JB67_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6R4T3_BALF1-0      --------------------------------------------------
A0A385J7X7_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1N2H2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6TWI9_BALF1-0      --------------------------------------------------
A0A4D6R8R0_BALF1-0      --------------------------------------------------
A0A3R5WV36_BALF1-0      --------------------------------------------------
A0A4D6RFR1_BALF1-0      --------------------------------------------------
A0A4D6RC31_BALF1-0      --------------------------------------------------
A0A4D6RBY3_BALF1-0      --------------------------------------------------
A0A3R5WYW3_BALF1-0      --------------------------------------------------
A0A3R5WNA2_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A410I1F1_BALF1-0      --------------------------------------------------
U5YUM6_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6RE52_BALF1-0      --------------------------------------------------
A0A7G1IXW1_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0A8IKW4_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6R8J3_BALF1-0      --------------------------------------------------
A0A2S1MZQ8_BALF1-0      atgaacctggccattactctggactctcctcacccaggcctcgcgtctta
A0A385JAB4_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6QXN1_BALF1-0      --------------------------------------------------
A0A4D6QMD2_BALF1-0      --------------------------------------------------
A0A410J0D8_BALF1-0      --------------------------------------------------
A0A410I9N0_BALF1-0      --------------------------------------------------
A0A3R5ZJV6_BALF1-0      --------------------------------------------------
A0A3R5WKR1_BALF1-0      --------------------------------------------------
A0A0U3UKR9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MXY9_BALF1-0      atgaacctggccattgctctggactttcctcacccaggcctcgcgtctta
A0A0S2YQW9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A385J8K7_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MV59_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MU91_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MM94_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0U3U737_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TLW1_BALF1-0      --------------------------------------------------
A0A1P7TZL6_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
P0CK59_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      atgaacctggccattgctctggactctcatcacccaggcctcgcgtctta
Q91HI3_BALF1-01         --------------------------------------------------
Q99F65_BALF1-01         --------------------------------------------------
H3ALX7_vNR13-01         --------------------------------------------------
Q9DH00_vNR13-01         --------------------------------------------------
Q9DH00_vNR13-02         --------------------------------------------------
A0A8C7EHJ2_vNR13-0      --------------------------------------------------
A0A8C2U8D6_vNR13-0      --------------------------------------------------
Q90343_vNR13-01         --------------------------------------------------
A0A674GY73_vNR13-0      --------------------------------------------------
A0A8C3KMB5_vNR13-0      --------------------------------------------------
A0A8D0KT43_vNR13-0      --------------------------------------------------
A0A663ECE3_vNR13-0      --------------------------------------------------
A0A8C4V604_vNR13-0      --------------------------------------------------
A0A8B9GHZ4_vNR13-0      --------------------------------------------------
A0A672TYX3_vNR13-0      --------------------------------------------------
A0A8C5RRS8_vNR13-0      --------------------------------------------------
A0A8C6YHI4_vNR13-0      --------------------------------------------------
A0A8D0KNJ6_vNR13-0      --------------------------------------------------
A0A670KGT8_vNR13-0      --------------------------------------------------
A0A8D2LWG1_vNR13-0      --------------------------------------------------
A0A8D0L3Y5_vNR13-0      --------------------------------------------------
A0A8C8VNX1_vNR13-0      --------------------------------------------------
A0A8C3SNB5_vNR13-0      --------------------------------------------------
A0A8C4VQB8_vNR13-0      --------------------------------------------------
A0A8C3IX63_vNR13-0      --------------------------------------------------
A0A674KEW6_vNR13-0      --------------------------------------------------
A1BM64_A9-01            --------------------------------------------------
Q2VSG7_A9-01            --------------------------------------------------
A0A1L2JVL1_A9-01        --------------------------------------------------
O36423_A9-01            --------------------------------------------------
Q1XBS8_VBCL2-01         --------------------------------------------------
Q1XBS6_VBCL2-01         --------------------------------------------------
Q1XBS7_VBCL2-01         --------------------------------------------------
Q99D15_VBCL2-01         --------------------------------------------------
Q9WH78_VBCL2-01         --------------------------------------------------
P89884_M11-01           --------------------------------------------------
B1PZP0_M11-01           --------------------------------------------------
A0A6M4EIA3_M11-01       --------------------------------------------------
D0U1R1_M11-01           --------------------------------------------------
Q9Q5K8_BHRF1-01         --------------------------------------------------
Q9WGB5_BHRF1-01         --------------------------------------------------
A0A0S0DHY9_BHRF1-0      --------------------------------------------------
Q8UZJ4_BHRF1-01         --------------------------------------------------
Q9IHR2_BHRF1-01         --------------------------------------------------
A0A0S2YQS0_BHRF1-0      --------------------------------------------------
A0A2H4Z4F2_BHRF1-0      --------------------------------------------------
A0A2S1N164_BHRF1-0      --------------------------------------------------
A0A2S1MYK7_BHRF1-0      --------------------------------------------------
A0A410IGR6_BHRF1-0      --------------------------------------------------
A0A4D6QZG6_BHRF1-0      --------------------------------------------------
A0A2H4Z4C5_BHRF1-0      --------------------------------------------------
A0A2S1MW70_BHRF1-0      --------------------------------------------------
A0A3R5TSC7_BHRF1-0      --------------------------------------------------
A0A451G5Y6_BHRF1-0      --------------------------------------------------
A0A3R5U6U7_BHRF1-0      --------------------------------------------------
A0A2S1MWX4_BHRF1-0      --------------------------------------------------
A0A2S1MX38_BHRF1-0      --------------------------------------------------
A0A451G617_BHRF1-0      --------------------------------------------------
A0A4D6QS84_BHRF1-0      --------------------------------------------------
A0A4D6R7N0_BHRF1-0      --------------------------------------------------
A0A2H4Z4M5_BHRF1-0      --------------------------------------------------
A0A2H4Z4H8_BHRF1-0      --------------------------------------------------
A0A2H4Z4I4_BHRF1-0      --------------------------------------------------
A0A0C7TQI4_BHRF1-0      --------------------------------------------------
A0A3R5UEL7_BHRF1-0      --------------------------------------------------
A0A2H4Z4I0_BHRF1-0      --------------------------------------------------
A0A3R5X5H4_BHRF1-0      --------------------------------------------------
A0A0B6VHG4_BHRF1-0      --------------------------------------------------
A0A2H4Z4D6_BHRF1-0      --------------------------------------------------
A0A0C7U1E2_BHRF1-0      --------------------------------------------------
A0A2S1N3G0_BHRF1-0      --------------------------------------------------
V5KUE2_BHRF1-02         --------------------------------------------------
A0A4D6TWZ3_BHRF1-0      --------------------------------------------------
A0A385J9R2_BHRF1-0      --------------------------------------------------
A0A0C7T924_BHRF1-0      --------------------------------------------------
A0A0C7T6R4_BHRF1-0      --------------------------------------------------
A0A385J8Q6_BHRF1-0      --------------------------------------------------
A0A4D6TV66_BHRF1-0      --------------------------------------------------
A0A0C7T306_BHRF1-0      --------------------------------------------------
A0A385J7D0_BHRF1-0      --------------------------------------------------
A0A4D6R3D4_BHRF1-0      --------------------------------------------------
A0A0X9C4Q9_BHRF1-0      --------------------------------------------------
A0A0X8YIW3_BHRF1-0      --------------------------------------------------
A0A4D6QKL8_BHRF1-0      --------------------------------------------------
A0A3R5TRD4_BHRF1-0      --------------------------------------------------
A0A385J922_BHRF1-0      --------------------------------------------------
A0A2H4Z4F8_BHRF1-0      --------------------------------------------------
A0A2H4Z4E3_BHRF1-0      --------------------------------------------------
A0A2H4Z4D9_BHRF1-0      --------------------------------------------------
K9UTF7_BHRF1-01         --------------------------------------------------
A0A0C7TWM2_BHRF1-0      --------------------------------------------------
A0A2D1LYW3_BHRF1-0      --------------------------------------------------
A0A0C7TK05_BHRF1-0      --------------------------------------------------
P03182_BHRF1-01         --------------------------------------------------
A0A410I865_BHRF1-0      --------------------------------------------------
A0A385JAL1_BHRF1-0      --------------------------------------------------
A0A2S1N3U3_BHRF1-0      --------------------------------------------------
A0A2S1MNB9_BHRF1-0      --------------------------------------------------
A0A2S1MMY2_BHRF1-0      --------------------------------------------------
A0A0S2YRE8_BHRF1-0      --------------------------------------------------
A0A0C7TX82_BHRF1-0      --------------------------------------------------
A0A0C7TTN2_BHRF1-0      --------------------------------------------------
A0A0C7TNT4_BHRF1-0      --------------------------------------------------
A0A0C7SXB3_BHRF1-0      --------------------------------------------------
K9UTN7_BHRF1-01         --------------------------------------------------
V5KU29_BHRF1-02         --------------------------------------------------
                                                                          

P90504_ORF16-01         --------------------------------------------------
F5HGJ3_ORF16-01         --------------------------------------------------
Q76RI8_ORF16-01         --------------------------------------------------
Q99F66_BALF1-01         --------------------------------------------------
A0A4D6QN24_BALF1-0      --------------------------------------------------
A0A385JB67_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6R4T3_BALF1-0      --------------------------------------------------
A0A385J7X7_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1N2H2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6TWI9_BALF1-0      --------------------------------------------------
A0A4D6R8R0_BALF1-0      --------------------------------------------------
A0A3R5WV36_BALF1-0      --------------------------------------------------
A0A4D6RFR1_BALF1-0      --------------------------------------------------
A0A4D6RC31_BALF1-0      --------------------------------------------------
A0A4D6RBY3_BALF1-0      --------------------------------------------------
A0A3R5WYW3_BALF1-0      --------------------------------------------------
A0A3R5WNA2_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A410I1F1_BALF1-0      --------------------------------------------------
U5YUM6_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6RE52_BALF1-0      --------------------------------------------------
A0A7G1IXW1_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0A8IKW4_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6R8J3_BALF1-0      --------------------------------------------------
A0A2S1MZQ8_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A385JAB4_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6QXN1_BALF1-0      --------------------------------------------------
A0A4D6QMD2_BALF1-0      --------------------------------------------------
A0A410J0D8_BALF1-0      --------------------------------------------------
A0A410I9N0_BALF1-0      --------------------------------------------------
A0A3R5ZJV6_BALF1-0      --------------------------------------------------
A0A3R5WKR1_BALF1-0      --------------------------------------------------
A0A0U3UKR9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgaact
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MXY9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0S2YQW9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A385J8K7_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MV59_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MU91_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MM94_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0U3U737_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TLW1_BALF1-0      --------------------------------------------------
A0A1P7TZL6_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
P0CK59_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
Q91HI3_BALF1-01         --------------------------------------------------
Q99F65_BALF1-01         --------------------------------------------------
H3ALX7_vNR13-01         --------------------------------------------------
Q9DH00_vNR13-01         --------------------------------------------------
Q9DH00_vNR13-02         --------------------------------------------------
A0A8C7EHJ2_vNR13-0      --------------------------------------------------
A0A8C2U8D6_vNR13-0      --------------------------------------------------
Q90343_vNR13-01         --------------------------------------------------
A0A674GY73_vNR13-0      --------------------------------------------------
A0A8C3KMB5_vNR13-0      --------------------------------------------------
A0A8D0KT43_vNR13-0      --------------------------------------------------
A0A663ECE3_vNR13-0      --------------------------------------------------
A0A8C4V604_vNR13-0      --------------------------------------------------
A0A8B9GHZ4_vNR13-0      --------------------------------------------------
A0A672TYX3_vNR13-0      --------------------------------------------------
A0A8C5RRS8_vNR13-0      --------------------------------------------------
A0A8C6YHI4_vNR13-0      --------------------------------------------------
A0A8D0KNJ6_vNR13-0      --------------------------------------------------
A0A670KGT8_vNR13-0      --------------------------------------------------
A0A8D2LWG1_vNR13-0      --------------------------------------------------
A0A8D0L3Y5_vNR13-0      --------------------------------------------------
A0A8C8VNX1_vNR13-0      --------------------------------------------------
A0A8C3SNB5_vNR13-0      --------------------------------------------------
A0A8C4VQB8_vNR13-0      --------------------------------------------------
A0A8C3IX63_vNR13-0      --------------------------------------------------
A0A674KEW6_vNR13-0      --------------------------------------------------
A1BM64_A9-01            --------------------------------------------------
Q2VSG7_A9-01            --------------------------------------------------
A0A1L2JVL1_A9-01        --------------------------------------------------
O36423_A9-01            --------------------------------------------------
Q1XBS8_VBCL2-01         --------------------------------------------------
Q1XBS6_VBCL2-01         --------------------------------------------------
Q1XBS7_VBCL2-01         --------------------------------------------------
Q99D15_VBCL2-01         --------------------------------------------------
Q9WH78_VBCL2-01         --------------------------------------------------
P89884_M11-01           --------------------------------------------------
B1PZP0_M11-01           --------------------------------------------------
A0A6M4EIA3_M11-01       --------------------------------------------------
D0U1R1_M11-01           --------------------------------------------------
Q9Q5K8_BHRF1-01         --------------------------------------------------
Q9WGB5_BHRF1-01         --------------------------------------------------
A0A0S0DHY9_BHRF1-0      --------------------------------------------------
Q8UZJ4_BHRF1-01         --------------------------------------------------
Q9IHR2_BHRF1-01         --------------------------------------------------
A0A0S2YQS0_BHRF1-0      --------------------------------------------------
A0A2H4Z4F2_BHRF1-0      --------------------------------------------------
A0A2S1N164_BHRF1-0      --------------------------------------------------
A0A2S1MYK7_BHRF1-0      --------------------------------------------------
A0A410IGR6_BHRF1-0      --------------------------------------------------
A0A4D6QZG6_BHRF1-0      --------------------------------------------------
A0A2H4Z4C5_BHRF1-0      --------------------------------------------------
A0A2S1MW70_BHRF1-0      --------------------------------------------------
A0A3R5TSC7_BHRF1-0      --------------------------------------------------
A0A451G5Y6_BHRF1-0      --------------------------------------------------
A0A3R5U6U7_BHRF1-0      --------------------------------------------------
A0A2S1MWX4_BHRF1-0      --------------------------------------------------
A0A2S1MX38_BHRF1-0      --------------------------------------------------
A0A451G617_BHRF1-0      --------------------------------------------------
A0A4D6QS84_BHRF1-0      --------------------------------------------------
A0A4D6R7N0_BHRF1-0      --------------------------------------------------
A0A2H4Z4M5_BHRF1-0      --------------------------------------------------
A0A2H4Z4H8_BHRF1-0      --------------------------------------------------
A0A2H4Z4I4_BHRF1-0      --------------------------------------------------
A0A0C7TQI4_BHRF1-0      --------------------------------------------------
A0A3R5UEL7_BHRF1-0      --------------------------------------------------
A0A2H4Z4I0_BHRF1-0      --------------------------------------------------
A0A3R5X5H4_BHRF1-0      --------------------------------------------------
A0A0B6VHG4_BHRF1-0      --------------------------------------------------
A0A2H4Z4D6_BHRF1-0      --------------------------------------------------
A0A0C7U1E2_BHRF1-0      --------------------------------------------------
A0A2S1N3G0_BHRF1-0      --------------------------------------------------
V5KUE2_BHRF1-02         --------------------------------------------------
A0A4D6TWZ3_BHRF1-0      --------------------------------------------------
A0A385J9R2_BHRF1-0      --------------------------------------------------
A0A0C7T924_BHRF1-0      --------------------------------------------------
A0A0C7T6R4_BHRF1-0      --------------------------------------------------
A0A385J8Q6_BHRF1-0      --------------------------------------------------
A0A4D6TV66_BHRF1-0      --------------------------------------------------
A0A0C7T306_BHRF1-0      --------------------------------------------------
A0A385J7D0_BHRF1-0      --------------------------------------------------
A0A4D6R3D4_BHRF1-0      --------------------------------------------------
A0A0X9C4Q9_BHRF1-0      --------------------------------------------------
A0A0X8YIW3_BHRF1-0      --------------------------------------------------
A0A4D6QKL8_BHRF1-0      --------------------------------------------------
A0A3R5TRD4_BHRF1-0      --------------------------------------------------
A0A385J922_BHRF1-0      --------------------------------------------------
A0A2H4Z4F8_BHRF1-0      --------------------------------------------------
A0A2H4Z4E3_BHRF1-0      --------------------------------------------------
A0A2H4Z4D9_BHRF1-0      --------------------------------------------------
K9UTF7_BHRF1-01         --------------------------------------------------
A0A0C7TWM2_BHRF1-0      --------------------------------------------------
A0A2D1LYW3_BHRF1-0      --------------------------------------------------
A0A0C7TK05_BHRF1-0      --------------------------------------------------
P03182_BHRF1-01         --------------------------------------------------
A0A410I865_BHRF1-0      --------------------------------------------------
A0A385JAL1_BHRF1-0      --------------------------------------------------
A0A2S1N3U3_BHRF1-0      --------------------------------------------------
A0A2S1MNB9_BHRF1-0      --------------------------------------------------
A0A2S1MMY2_BHRF1-0      --------------------------------------------------
A0A0S2YRE8_BHRF1-0      --------------------------------------------------
A0A0C7TX82_BHRF1-0      --------------------------------------------------
A0A0C7TTN2_BHRF1-0      --------------------------------------------------
A0A0C7TNT4_BHRF1-0      --------------------------------------------------
A0A0C7SXB3_BHRF1-0      --------------------------------------------------
K9UTN7_BHRF1-01         --------------------------------------------------
V5KU29_BHRF1-02         --------------------------------------------------
                                                                          

P90504_ORF16-01         --------------atggacgaggacgttttgcctggagaggt--gttgg
F5HGJ3_ORF16-01         --------------atggacgaggacgttttgcctggagaggt--gttgg
Q76RI8_ORF16-01         --------------atggacgaggacgttttgcctggagaggt--gttgg
Q99F66_BALF1-01         --------------atg---aaggccgccaagtctacagattc--ggtgt
A0A4D6QN24_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A385JB67_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A4D6R4T3_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A385J7X7_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A0C7TV67_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A2S1N1Z2_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A2S1N2H2_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A4D6TWI9_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A4D6R8R0_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A3R5WV36_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A4D6RFR1_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A4D6RC31_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A4D6RBY3_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A3R5WYW3_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A3R5WNA2_BALF1-0      --------------atg---aggccagccaagactacagattc--tgtgt
A0A075FFB0_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A075FCZ0_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A410I1F1_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
U5YUM6_BALF1-01         ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A4D6RE52_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A7G1IXW1_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A0A8IKW4_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A4D6R8J3_BALF1-0      --------------atg---aagccagccaagtctacagattc--tgtgt
A0A2S1MZQ8_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A385JAB4_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagatgc--tgtgt
A0A4D6QXN1_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A4D6QMD2_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A410J0D8_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A410I9N0_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A3R5ZJV6_BALF1-0      --------------atg---aggccaaccaagtctacagattc--tgtgt
A0A3R5WKR1_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A0U3UKR9_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A2D1LYV4_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
Q91HV2_BALF1-01         ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A0C7TPI3_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A2S1MQV1_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A0C7T8J1_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A2S1MP06_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A2S1MXY9_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A0S2YQW9_BALF1-0      ggcctgacgagaccatg---aggcaagccaagtctacagattc--tgtgt
A0A0C7TJ32_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A385J8K7_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A2S1MV59_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A2S1MU91_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A2S1MM94_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A0U3U737_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A0C7TLW1_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
A0A1P7TZL6_BALF1-0      --------------atg---aggccagccaagtctacagattc--tgtgt
K9UT94_BALF1-01         --------------atg---aggccagccaagtctacagattc--tgtgt
P0CK58_BALF1-01         ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
P0CK59_BALF1-01         ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
A0A0C7TUX3_BALF1-0      --------------atg---aggcaagccaagtctacagattc--tgtgt
A0A2S1MTH2_BALF1-0      ggcctgacgagaccatg---aggccagccaagtctacagattc--tgtgt
Q91HI3_BALF1-01         --------------atg---aggccggccaagtctacagattc--cgtgt
Q99F65_BALF1-01         --------------atg---aggccagccgagtctacagattc--cgtgt
H3ALX7_vNR13-01         --------------atgt-gcgattcgttgaaagaggaaaccc--gactc
Q9DH00_vNR13-01         --------------atgg-ctgactccctgaaggaagaaacgg--cgttg
Q9DH00_vNR13-02         --------------atgg-ctgactccctgaaggaagaaacgg--cgttg
A0A8C7EHJ2_vNR13-0      --------------atgc-cgggctcgctgaaggaggagacgg--cgctg
A0A8C2U8D6_vNR13-0      --------------atgc-cgggctctctgaaggaggagacgg--cgctg
Q90343_vNR13-01         --------------atgc-cgggctctctgaaggaggagacgg--cgctg
A0A674GY73_vNR13-0      --------------atgc-cgcgctcgctgaaggaggagacgg--cgctg
A0A8C3KMB5_vNR13-0      --------------atgc-cgggctcgctgaaggaggagacgg--cgctg
A0A8D0KT43_vNR13-0      --------------atgc-cgggctcgctgaaggaggagacgg--cgctg
A0A663ECE3_vNR13-0      --------------atgc-cgagctcgctgaaggaggagacgg--cgctg
A0A8C4V604_vNR13-0      --------------atgc-cgggctcgctgaaggaggagacgg--cgctg
A0A8B9GHZ4_vNR13-0      --------------atgc-cgggctcgctgaaggaagagacgg--cgctg
A0A672TYX3_vNR13-0      --------------atgc-cgagctcgctgaaggaggagacgg--cgctg
A0A8C5RRS8_vNR13-0      --------------atgc-cgggcgcgctccgcgaagagacgg--cgcag
A0A8C6YHI4_vNR13-0      --------------atgc-cgggcgcgctccgcgaagagacgg--cgcag
A0A8D0KNJ6_vNR13-0      --------------atgc-cgggcgcgctgcgcgaggagacgg--tgcgg
A0A670KGT8_vNR13-0      --------------atgc-cgggcgcgctgcgcgaggagacgg--tgcag
A0A8D2LWG1_vNR13-0      --------------atgc-cgggcgcgctgcgcgaggagacgg--cgcag
A0A8D0L3Y5_vNR13-0      --------------atgc-cgggcgcgctggaggaggagacgg--cgtta
A0A8C8VNX1_vNR13-0      --------------atgc-cgggctcgctgaaggagcagacgg--cgctg
A0A8C3SNB5_vNR13-0      --------------atgc-cgggctcgctgaaggagcagacgg--tgctg
A0A8C4VQB8_vNR13-0      --------------atgc-cgggctcgctgaaggagcagacgg--cgctg
A0A8C3IX63_vNR13-0      --------------atgc-cgggctcgctgaaggagcagacgg--cgctg
A0A674KEW6_vNR13-0      --------------atgc-cgggctcgctgaaggagcagacgg--cgctg
A1BM64_A9-01            --------------atggtggaagctggcatactatcaaggaa--agtaa
Q2VSG7_A9-01            --------------atggtggaagctggcatactatcaaggaa--agtaa
A0A1L2JVL1_A9-01        --------------atga------------------------------aa
O36423_A9-01            --------------atga------------------------------aa
Q1XBS8_VBCL2-01         --------------atgtc-------------tct----------gtttt
Q1XBS6_VBCL2-01         --------------atgtc-------------tct----------gtttt
Q1XBS7_VBCL2-01         --------------atgtc-------------tct----------gtttt
Q99D15_VBCL2-01         --------------atgtc-------------tct----------gtttt
Q9WH78_VBCL2-01         --------------atgtc-------------tct----------gtttt
P89884_M11-01           --------------atgag-------------tcataagaaaagcgggac
B1PZP0_M11-01           --------------atgag-------------tcataagaaaagcgggac
A0A6M4EIA3_M11-01       --------------atgag-------------tcataagaaaagcgggac
D0U1R1_M11-01           --------------atgag-------------tcataagaggactgggac
Q9Q5K8_BHRF1-01         --------------atggc-------------ctattctacaa--gggat
Q9WGB5_BHRF1-01         --------------atggc-------------ctattctacaa--gggat
A0A0S0DHY9_BHRF1-0      --------------atggc-------------cttttcaacaa--gagat
Q8UZJ4_BHRF1-01         --------------atggc-------------cttttcaacaa--gagat
Q9IHR2_BHRF1-01         --------------atggc-------------ctattcaacaa--gggat
A0A0S2YQS0_BHRF1-0      --------------atggc-------------ccattcaacaa--gggag
A0A2H4Z4F2_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2S1N164_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2S1MYK7_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A410IGR6_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A4D6QZG6_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2H4Z4C5_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2S1MW70_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A3R5TSC7_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A451G5Y6_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A3R5U6U7_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2S1MWX4_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2S1MX38_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A451G617_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A4D6QS84_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A4D6R7N0_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2H4Z4M5_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2H4Z4H8_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2H4Z4I4_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0C7TQI4_BHRF1-0      --------------atggc-------------ctattcaacaa--gggat
A0A3R5UEL7_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2H4Z4I0_BHRF1-0      --------------atggc-------------ctattcaacaa--gggat
A0A3R5X5H4_BHRF1-0      --------------atggc-------------ctattcaacaa--gggat
A0A0B6VHG4_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2H4Z4D6_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0C7U1E2_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2S1N3G0_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
V5KUE2_BHRF1-02         --------------atggc-------------ctattcaacaa--gggag
A0A4D6TWZ3_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A385J9R2_BHRF1-0      --------------atggc-------------ttattcaacaa--gggag
A0A0C7T924_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0C7T6R4_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A385J8Q6_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A4D6TV66_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0C7T306_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A385J7D0_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A4D6R3D4_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0X9C4Q9_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0X8YIW3_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A4D6QKL8_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A3R5TRD4_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A385J922_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2H4Z4F8_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2H4Z4E3_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2H4Z4D9_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
K9UTF7_BHRF1-01         --------------atggc-------------ctattcaacaa--gggag
A0A0C7TWM2_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2D1LYW3_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0C7TK05_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
P03182_BHRF1-01         --------------atggc-------------ctattcaacaa--gggag
A0A410I865_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A385JAL1_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2S1N3U3_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2S1MNB9_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A2S1MMY2_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0S2YRE8_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0C7TX82_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0C7TTN2_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0C7TNT4_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
A0A0C7SXB3_BHRF1-0      --------------atggc-------------ctattcaacaa--gggag
K9UTN7_BHRF1-01         --------------atggc-------------ctattcaacaa--gggag
V5KU29_BHRF1-02         --------------atggc-------------ctattcaacaa--gggag
                                      ***                                 

P90504_ORF16-01         ccattgaagggatattcatggcctgtggattaaacgaacctgagtacctg
F5HGJ3_ORF16-01         ccattgaagggatattcatggcctgtggattaaacgaacctgagtacctg
Q76RI8_ORF16-01         ccattgaagggatattcatggcctgtggattaaacgaacctgagtacctg
Q99F66_BALF1-01         ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6QN24_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A385JB67_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6R4T3_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtgga
A0A385J7X7_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0C7TV67_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1N1Z2_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1N2H2_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6TWI9_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6R8R0_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A3R5WV36_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6RFR1_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6RC31_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6RBY3_BALF1-0      ttgt--gaggac---------cccggtcg------------atgcgtggg
A0A3R5WYW3_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A3R5WNA2_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A075FFB0_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A075FCZ0_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A410I1F1_BALF1-0      ttgt--gaagac---------cccggtcg------------aggcgtggg
U5YUM6_BALF1-01         ttgt--gaagac---------cccggtcg------------aggcgtggg
A0A4D6RE52_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A7G1IXW1_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0A8IKW4_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6R8J3_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1MZQ8_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A385JAB4_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6QXN1_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A4D6QMD2_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A410J0D8_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A410I9N0_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A3R5ZJV6_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A3R5WKR1_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0U3UKR9_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2D1LYV4_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
Q91HV2_BALF1-01         ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0C7TPI3_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1MQV1_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0C7T8J1_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1MP06_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1MXY9_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0S2YQW9_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0C7TJ32_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A385J8K7_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1MV59_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1MU91_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1MM94_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0U3U737_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0C7TLW1_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A1P7TZL6_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
K9UT94_BALF1-01         ttgt--gaggac---------cccggtcg------------aggcgtggg
P0CK58_BALF1-01         ttgt--gaggac---------cccggtcg------------aggcgtggg
P0CK59_BALF1-01         ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A0C7TUX3_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
A0A2S1MTH2_BALF1-0      ttgt--gaggac---------cccggtcg------------aggcgtggg
Q91HI3_BALF1-01         ttgt--gaggac---------cccagtag------------aggcgtggg
Q99F65_BALF1-01         ttgt--gaggac---------cccggtcg------------aggcgtggg
H3ALX7_vNR13-01         ttggctaacgatttcatccagttttgcct------------cggcagcgg
Q9DH00_vNR13-01         ctgctggaggattacttccagcactgctg------------cggcaag-g
Q9DH00_vNR13-02         ctgctggaggattacttccagcactgctg------------cggcaag-g
A0A8C7EHJ2_vNR13-0      ctgctccaggactacttcgagcaccggcg------------cggcggc-g
A0A8C2U8D6_vNR13-0      ctgctggaggattacttccagcaccgggc------------cggcggg-g
Q90343_vNR13-01         ctgctggaggattacttccagcaccgggc------------cggcggg-g
A0A674GY73_vNR13-0      ctgctggaggattacttccagcaccgcag------------cggcagc-g
A0A8C3KMB5_vNR13-0      ctgctggaggattacttccagcaccgcgg------------cggcggc-t
A0A8D0KT43_vNR13-0      ctgctggaggactacttccagcaccgcgg------------cggcggc-g
A0A663ECE3_vNR13-0      ctgctggaggactacttccagcaccgggg------------cggcggc-g
A0A8C4V604_vNR13-0      ctgctggaggactacttccagcaccgggg------------cggcggc-g
A0A8B9GHZ4_vNR13-0      ctgctggaggactacttccagcaccgcag------------cggcggc-a
A0A672TYX3_vNR13-0      ctgctggaggactacttccagcaccgccg------------cggcggc-a
A0A8C5RRS8_vNR13-0      ctgctgggcgactacgtgcagcaccggct------------ggggggc-g
A0A8C6YHI4_vNR13-0      ctgctgggcgactacgtgcagcaccggct------------ggggggc-g
A0A8D0KNJ6_vNR13-0      ctgctgggcgactacttgcagcaccggct---------cgggcgcggc-g
A0A670KGT8_vNR13-0      ctgatggccgactacttgcagcaccggctcggcggcggcgggggcgcc-g
A0A8D2LWG1_vNR13-0      ctgctggccgactacttccagcaccggct------------gggggcc-g
A0A8D0L3Y5_vNR13-0      ttgctggccgactactttcagcaccgcct------------cgggggc-g
A0A8C8VNX1_vNR13-0      ctgctggcagattatttccagcaccgcct------------ggggggc-g
A0A8C3SNB5_vNR13-0      ctgctgggcgattacttccagcaccgcct------------ggggggc-c
A0A8C4VQB8_vNR13-0      ctgttgggcgactacttccagcaccgcct------------gggggac-g
A0A8C3IX63_vNR13-0      ctgctgggcgattacttccagcaccgcct------------ggggggc-c
A0A674KEW6_vNR13-0      ctgctgggcgattacttccagcaccgcct------------ggggggc-c
A1BM64_A9-01            ccactgggagccactggact--------t------------tcttcaccc
Q2VSG7_A9-01            ccactgggagccactggact--------t------------tcttcaccc
A0A1L2JVL1_A9-01        atgttgggagaacccgagt---------t------------taaggagaa
O36423_A9-01            atgttgggagaacccgagt---------t------------taaggagaa
Q1XBS8_VBCL2-01         ttattgtttggtactgggtg---aattat------------ataacaaag
Q1XBS6_VBCL2-01         ttgttgtttggtactgggtg---aattat------------ataacaaag
Q1XBS7_VBCL2-01         ttgttgtttggtactgggtg---aattat------------ataacaaag
Q99D15_VBCL2-01         ttgttgtttggtactgggtg---aattat------------ataacaaag
Q9WH78_VBCL2-01         ttgttgtttggtactgggtg---aattat------------ataacaaag
P89884_M11-01           ttattgggcaaccctgattacagccttct------------tgaagactg
B1PZP0_M11-01           ttattgggcaaccctgattacagccttct------------tgaagactg
A0A6M4EIA3_M11-01       ttattgggcaaccctgattacagccttct------------tgaagactg
D0U1R1_M11-01           ttattgggcaaccataattactgcctttt------------tgaagtctg
Q9Q5K8_BHRF1-01         ttact-gttagctttgtgta--------t------------gcgggatgg
Q9WGB5_BHRF1-01         ttact-gttagctttgtgta--------t------------gcgggatgg
A0A0S0DHY9_BHRF1-0      ttact-gttagccctgtgta--------t------------gcgggacag
Q8UZJ4_BHRF1-01         ttact-gttagccctgtgta--------t------------gcgggacag
Q9IHR2_BHRF1-01         atact-gttagccctgtgta--------t------------gcgggacag
A0A0S2YQS0_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4F2_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2S1N164_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2S1MYK7_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A410IGR6_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A4D6QZG6_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4C5_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2S1MW70_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A3R5TSC7_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A451G5Y6_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A3R5U6U7_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2S1MWX4_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2S1MX38_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A451G617_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A4D6QS84_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A4D6R7N0_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4M5_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4H8_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4I4_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7TQI4_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A3R5UEL7_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4I0_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A3R5X5H4_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0B6VHG4_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4D6_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7U1E2_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2S1N3G0_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
V5KUE2_BHRF1-02         atact-gttagccctgtgta--------t------------acgggacag
A0A4D6TWZ3_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A385J9R2_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7T924_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7T6R4_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A385J8Q6_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A4D6TV66_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7T306_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A385J7D0_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A4D6R3D4_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0X9C4Q9_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0X8YIW3_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A4D6QKL8_BHRF1-0      atact-gttagccctgtgta--------c------------acgggacag
A0A3R5TRD4_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A385J922_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4F8_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4E3_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2H4Z4D9_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
K9UTF7_BHRF1-01         atact-gttagccctgtgta--------t------------acgggacag
A0A0C7TWM2_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2D1LYW3_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7TK05_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
P03182_BHRF1-01         atact-gttagccctgtgta--------t------------acgggacag
A0A410I865_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A385JAL1_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2S1N3U3_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2S1MNB9_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A2S1MMY2_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0S2YRE8_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7TX82_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7TTN2_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7TNT4_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
A0A0C7SXB3_BHRF1-0      atact-gttagccctgtgta--------t------------acgggacag
K9UTN7_BHRF1-01         atact-gttagccctgtgta--------t------------acgggacag
V5KU29_BHRF1-02         atact-gttagccctgtgta--------t------------acgggacag
                                                                          

P90504_ORF16-01         taccatcct--ttgctcagccctatta---------------------ag
F5HGJ3_ORF16-01         taccatcct--ttgctcagccctatta---------------------ag
Q76RI8_ORF16-01         taccatcct--ttgctcagccctatta---------------------ag
Q99F66_BALF1-01         tctcgccttccccgcccgacgacaaggtcgcggagaccagctacctcctt
A0A4D6QN24_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A385JB67_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A4D6R4T3_BALF1-0      tcgcgccctcgacgccagacgacaaggtggctgagtccagctacctcatg
A0A385J7X7_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0C7TV67_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1N1Z2_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1N2H2_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A4D6TWI9_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A4D6R8R0_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A3R5WV36_BALF1-0      tcgcgccctcgccgccggacgataaggtggctgagtccagctacctcatg
A0A4D6RFR1_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A4D6RC31_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A4D6RBY3_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A3R5WYW3_BALF1-0      tcgcgccctcgccgccggacgacagggtggctgagtccagctacctcatg
A0A3R5WNA2_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A075FFB0_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A075FCZ0_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A410I1F1_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
U5YUM6_BALF1-01         tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A4D6RE52_BALF1-0      tcgcgccctcgtcgccggacgacaaggtggctgagtccagctacctcatg
A0A7G1IXW1_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0A8IKW4_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A4D6R8J3_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1MZQ8_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A385JAB4_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A4D6QXN1_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A4D6QMD2_BALF1-0      tcgcgccctcgccgccggacaacaaggtggctgagtccagctacctcatg
A0A410J0D8_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A410I9N0_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A3R5ZJV6_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A3R5WKR1_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0U3UKR9_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2D1LYV4_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
Q91HV2_BALF1-01         tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0C7TPI3_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1MQV1_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0C7T8J1_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1MP06_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1MXY9_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0S2YQW9_BALF1-0      tcgcgccatcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0C7TJ32_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A385J8K7_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1MV59_BALF1-0      tcgcgcccttgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1MU91_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1MM94_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0U3U737_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0C7TLW1_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A1P7TZL6_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
K9UT94_BALF1-01         tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
P0CK58_BALF1-01         tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
P0CK59_BALF1-01         tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A0C7TUX3_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
A0A2S1MTH2_BALF1-0      tcgcgccctcgccgccggacgacaaggtggctgagtccagctacctcatg
Q91HI3_BALF1-01         tcgcgccatcgcctccggacgacaaggtggcggagtccagctacctcatg
Q99F65_BALF1-01         tcgcgccgtcgccgccggacgacaaggtggccgagtccagctacctcatg
H3ALX7_vNR13-01         ccggactg----cccccaaccctgcagcccgggtcc------------tg
Q9DH00_vNR13-01         aagggccg---ccgccgagtcctacggcggcagagc------------tg
Q9DH00_vNR13-02         aagggccg---ccgccgagtcctacggcggcagagc------------tg
A0A8C7EHJ2_vNR13-0      ccgcgctg---ccgcccagcgccacggcggccacgc------------tg
A0A8C2U8D6_vNR13-0      ccgcgctg---cctcccagcgccacggcggccgagc------------tg
Q90343_vNR13-01         ccgcgctg---cctcccagcgccacggcggccgagc------------tg
A0A674GY73_vNR13-0      ccgcgctg---ccccccagccccacggcggccgtgc------------tg
A0A8C3KMB5_vNR13-0      cggcgctg---ccccccagccccacggcggcggtgc------------tg
A0A8D0KT43_vNR13-0      ccgcgctg---ccccccagccccacggcggccacgc------------tg
A0A663ECE3_vNR13-0      ccgcgctg---ccccccagccccacggcggccacgc------------tg
A0A8C4V604_vNR13-0      ccgcgctg---ccccccagccccacggcggccacgc------------tg
A0A8B9GHZ4_vNR13-0      gcgcgctg---ccccccagccccacggcggctacgc------------tg
A0A672TYX3_vNR13-0      gcgcgctg---ccccccagccccacggcggccacgc------------tg
A0A8C5RRS8_vNR13-0      cggcgctgcctccgccgagccgcgcggccgagacgc------------tg
A0A8C6YHI4_vNR13-0      cggcgctgcctccgccgagccgcacggccgagacgc------------tg
A0A8D0KNJ6_vNR13-0      cggcgccg---cctcccagccgcccggcggagacgc------------tg
A0A670KGT8_vNR13-0      cggcgctg---ccgcccagccgcacggccgagacgc------------tg
A0A8D2LWG1_vNR13-0      cggcgctg---ccgcccagccgcacggccgagacgc------------tg
A0A8D0L3Y5_vNR13-0      cggcgctgcctcca---agccccacggcccagacac------------tg
A0A8C8VNX1_vNR13-0      cagcg--gccg-cacccagcccggcggccgagacgc------------tg
A0A8C3SNB5_vNR13-0      cggcgctgccgccgcccagccccgcggccgagacgc------------tg
A0A8C4VQB8_vNR13-0      cggcgctgccgccgcccagccccgcggccgagacgc------------tg
A0A8C3IX63_vNR13-0      cggcgctgccgccgcccagccccgcggccgagacgc------------tg
A0A674KEW6_vNR13-0      cggcgctgccgccgcccagccccgcggccgagacgc------------tg
A1BM64_A9-01            ctcaaacc---------------ttgaagaaagggg------------ct
Q2VSG7_A9-01            cccaaacc---------------ttgaagaaagggg------------ct
A0A1L2JVL1_A9-01        catcctct---------------at--------tat------------tc
O36423_A9-01            catcctct---------------at--------tat------------tc
Q1XBS8_VBCL2-01         gtgtgttc---------------tggggaggtatat------------at
Q1XBS6_VBCL2-01         gtgtgttc---------------tggggaggtatat------------at
Q1XBS7_VBCL2-01         gtgtgttc---------------tggggaggtatat------------at
Q99D15_VBCL2-01         gtgtgttt---------------tggggaggtatat------------at
Q9WH78_VBCL2-01         gtgtgttc---------------tggggaggtatat------------at
P89884_M11-01           tttctaaa---------------gtggaagaactgg------------at
B1PZP0_M11-01           tttctaaa---------------gtggaagaactgg------------at
A0A6M4EIA3_M11-01       tttctaaa---------------gtggaagaactgg------------at
D0U1R1_M11-01           tttctaag---------------gtggaagaactgg------------at
Q9Q5K8_BHRF1-01         tcacgttt---------------atggaggcgacgg------------tt
Q9WGB5_BHRF1-01         tcacgttt---------------atggaggcgacgg------------tt
A0A0S0DHY9_BHRF1-0      tcacgttc---------------atggaaacgaggg------------tc
Q8UZJ4_BHRF1-01         tcacgttc---------------atggaaacgaggg------------tc
Q9IHR2_BHRF1-01         ttacgtgc---------------atggaaatggatc------------tt
A0A0S2YQS0_BHRF1-0      tcgtgtgc---------------atggaaatggtgt------------cc
A0A2H4Z4F2_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2S1N164_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2S1MYK7_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A410IGR6_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A4D6QZG6_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2H4Z4C5_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2S1MW70_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A3R5TSC7_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A451G5Y6_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A3R5U6U7_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2S1MWX4_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2S1MX38_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A451G617_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A4D6QS84_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A4D6R7N0_BHRF1-0      tcgtgtgc---------------atggaaatggtcc------------cc
A0A2H4Z4M5_BHRF1-0      tcgtgtgc---------------atggaaatggttc------------cc
A0A2H4Z4H8_BHRF1-0      tcgtgtgc---------------atggaaatgcttc------------cc
A0A2H4Z4I4_BHRF1-0      tcgtgtgc---------------atggaaatggttc------------cc
A0A0C7TQI4_BHRF1-0      tcgtgtgc---------------atggaaatggtgc------------cc
A0A3R5UEL7_BHRF1-0      tcgtgtgc---------------atggaaatggtgc------------cc
A0A2H4Z4I0_BHRF1-0      tcgtgtgc---------------atggaaatggtgc------------cc
A0A3R5X5H4_BHRF1-0      tcgtgtgc---------------atggaaatggtgc------------cc
A0A0B6VHG4_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2H4Z4D6_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7U1E2_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2S1N3G0_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
V5KUE2_BHRF1-02         tcgtgtgc---------------atggaaatggtac------------cc
A0A4D6TWZ3_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A385J9R2_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7T924_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7T6R4_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A385J8Q6_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A4D6TV66_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7T306_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A385J7D0_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A4D6R3D4_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0X9C4Q9_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0X8YIW3_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A4D6QKL8_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A3R5TRD4_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A385J922_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2H4Z4F8_BHRF1-0      tcgtgtgc---------------atggaaatggtat------------cc
A0A2H4Z4E3_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2H4Z4D9_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
K9UTF7_BHRF1-01         tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7TWM2_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2D1LYW3_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7TK05_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
P03182_BHRF1-01         tcgtgtgc---------------atggaaatggtac------------cc
A0A410I865_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A385JAL1_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2S1N3U3_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2S1MNB9_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A2S1MMY2_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0S2YRE8_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7TX82_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7TTN2_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7TNT4_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
A0A0C7SXB3_BHRF1-0      tcgtgtgc---------------atggaaatggtac------------cc
K9UTN7_BHRF1-01         tcgtgtgc---------------atggaaatggtac------------cc
V5KU29_BHRF1-02         tcgtgtgc---------------atggaaatggtac------------cc
                                                                          

P90504_ORF16-01         ctatacatcacaggcttaatg------cgagacaagg--agtctttattc
F5HGJ3_ORF16-01         ctatacatcacaggcttaatg------cgagacaagg--agtctttattc
Q76RI8_ORF16-01         ctatacatcacaggcttaatg------cgagacaagg--agtctttattc
Q99F66_BALF1-01         tttagggccatgtacgcggtgttcacccaggacgagactgacctgcccac
A0A4D6QN24_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A385JB67_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A4D6R4T3_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A385J7X7_BALF1-0      ttcagagccatgtacgcggtgttcgccagggatgagaaagacctgccttt
A0A0C7TV67_BALF1-0      ttcagagccatgtacgcggtgttcgcccgggatgagaaagacctgccttt
A0A2S1N1Z2_BALF1-0      ttcagagccatgtacgcggtgttcgcccgggatgagaaagacctgccttt
A0A2S1N2H2_BALF1-0      ttcagagccatgtacgcggtgttcgcccgggatgagaaagacctgccttt
A0A4D6TWI9_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A4D6R8R0_BALF1-0      ttcagggccatgtacgcggtgttcaccagggatgagaaagacctgccttt
A0A3R5WV36_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A4D6RFR1_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A4D6RC31_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A4D6RBY3_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A3R5WYW3_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A3R5WNA2_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A075FFB0_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A075FCZ0_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A410I1F1_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
U5YUM6_BALF1-01         ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A4D6RE52_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A7G1IXW1_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A0A8IKW4_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A4D6R8J3_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A2S1MZQ8_BALF1-0      ttcagagccatgtacgcggtgttcgcccgggatgagaaagacctgccttt
A0A385JAB4_BALF1-0      ttcagggccatgtatgcggtgttcacccgggatgagaaagacctgccttt
A0A4D6QXN1_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A4D6QMD2_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A410J0D8_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A410I9N0_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A3R5ZJV6_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A3R5WKR1_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagacagacctgccttt
A0A0U3UKR9_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A2D1LYV4_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
Q91HV2_BALF1-01         ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A0C7TPI3_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A2S1MQV1_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A0C7T8J1_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A2S1MP06_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A2S1MXY9_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A0S2YQW9_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A0C7TJ32_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A385J8K7_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaaaacctgccttt
A0A2S1MV59_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A2S1MU91_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A2S1MM94_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A0U3U737_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A0C7TLW1_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A1P7TZL6_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
K9UT94_BALF1-01         ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
P0CK58_BALF1-01         ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
P0CK59_BALF1-01         ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A0C7TUX3_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
A0A2S1MTH2_BALF1-0      ttcagggccatgtacgcggtgttcacccgggatgagaaagacctgccttt
Q91HI3_BALF1-01         ttcagggcaatgtacgcggtgttcacccaggatgagacgggcctgcctct
Q99F65_BALF1-01         ttcagggcaatgtacgcggtgttctcccgggatgagtcggacctgccgct
H3ALX7_vNR13-01         cgcagggtgacagcggaactgg-----agcggcagaaccaggcgctcttc
Q9DH00_vNR13-01         cggcgagcggcggccgagctgg-----agcggcgagagaggcccttcttt
Q9DH00_vNR13-02         cggcgagcggcggccgagctgg-----agcggcgagagaggcccttcttt
A0A8C7EHJ2_vNR13-0      cggcgggcggcgggcgagctgg-----agcggcgcgagcggcccttcttc
A0A8C2U8D6_vNR13-0      cggcgggcggcggccgagctgg-----agcgacgggagcggcccttcttc
Q90343_vNR13-01         cggcgggcggcggccgagctgg-----agcgacgggagcggcccttcttc
A0A674GY73_vNR13-0      cggcgggcggcggccgagctgg-----agcggcaggagcggcccttcttc
A0A8C3KMB5_vNR13-0      aggcgggcggcggccgagctgg-----agcggcgggagcggcccttcttc
A0A8D0KT43_vNR13-0      cggcgggcggcggccgagctgg-----agcggcgggagcggcccttcttc
A0A663ECE3_vNR13-0      cggcgggcggcggccgagctgg-----agcggcgggagcggcccttcttc
A0A8C4V604_vNR13-0      cggcgggcggcggccgagctgg-----agcggcgggagcggcccttcttc
A0A8B9GHZ4_vNR13-0      cggcgggcggcggccgagctgg-----agcggcaggagcgggtcttcttc
A0A672TYX3_vNR13-0      cggcgggcggcggccgagctgg-----agcggcaggagcgggtcttcttc
A0A8C5RRS8_vNR13-0      cgccgggtggccgacgagctgg-----agagccgggagcgcctcttcttc
A0A8C6YHI4_vNR13-0      cggcgggtggccgacgagctgg-----agagccgcgagcgcctcttcttc
A0A8D0KNJ6_vNR13-0      cgccgggtggccgacgagctgg-----agagccgcgagcggcctttcttc
A0A670KGT8_vNR13-0      cggcgggtggccgacgagctgg-----agagccgcgagcggcccttcttc
A0A8D2LWG1_vNR13-0      cgccgggtggccgacgagctgg-----agagccgcgagcggccgttcttc
A0A8D0L3Y5_vNR13-0      cggcgagtggccggcgagctgg-----agagccgggagcggcccttcttc
A0A8C8VNX1_vNR13-0      cggcgggcggccagcgagctgg-----agagccgggagcggcccttcttc
A0A8C3SNB5_vNR13-0      cggcgggcggccagcgagctgg-----agagccgggagcggcccttcttc
A0A8C4VQB8_vNR13-0      cggcgggtggccagcgagctgg-----agagccgggagcggcccttcttc
A0A8C3IX63_vNR13-0      cggcgggcggccagcgagctgg-----agagccgggagcggcccttcttc
A0A674KEW6_vNR13-0      cggcgggcggccagcgagctgg-----agagccgggagcggcccttcttc
A1BM64_A9-01            tgcctgtggaaggctggggcagtatatttccccccagcaagcatgccccc
Q2VSG7_A9-01            tgtctgtggaaggctggggcagtatatttccccccagtaagcatgccccc
A0A1L2JVL1_A9-01        attcctaaatgaactgtttttaa---tattaataagaaatggattttcct
O36423_A9-01            attcctaaatgaactgtttttaa---tattaataagaaatggattttcct
Q1XBS8_VBCL2-01         tccaa--------gtgtattaaa-gtt----------tcaatatcactct
Q1XBS6_VBCL2-01         tccaa--------gtgtattaaa-gtt----------tcaatatcactct
Q1XBS7_VBCL2-01         tccaa--------gtgtattaaa-gtt----------tcaatatcactct
Q99D15_VBCL2-01         tccaa--------gtgtattaaa-gtt----------tcaatatcactct
Q9WH78_VBCL2-01         tccaa--------gtgtattaaa-gtt----------tcaatatcactct
P89884_M11-01           tgtgttgattctgctgtgttagttgatgtctctaaaataataacattgac
B1PZP0_M11-01           tgtgttgattctgctgtgttagttgatgtctctaaaataataacattgac
A0A6M4EIA3_M11-01       tgtgttgattctgctgtgttagttgatgtctctaaaataataacattgac
D0U1R1_M11-01           tgctatgattcggatgtgttggatgatgtctcgaaaatcataacattgac
Q9Q5K8_BHRF1-01         tgcatc-------ctgtgttgga-gttgacagcaagagaatcacctttca
Q9WGB5_BHRF1-01         tgcatc-------ctgtgttgga-gttgacagcaagagaatcacctttca
A0A0S0DHY9_BHRF1-0      tgcatc-------ctgtgttgga-gttagcatcaagagaatcaccctcca
Q8UZJ4_BHRF1-01         tgcatc-------ctgtgttgga-gttagcatcaagagaatcaccctcca
Q9IHR2_BHRF1-01         tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctcctc
A0A0S2YQS0_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctcccc
A0A2H4Z4F2_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2S1N164_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2S1MYK7_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctct
A0A410IGR6_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A4D6QZG6_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2H4Z4C5_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2S1MW70_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A3R5TSC7_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A451G5Y6_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A3R5U6U7_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2S1MWX4_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2S1MX38_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A451G617_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A4D6QS84_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A4D6R7N0_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2H4Z4M5_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2H4Z4H8_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2H4Z4I4_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7TQI4_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctcccc
A0A3R5UEL7_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctcccc
A0A2H4Z4I0_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctcccc
A0A3R5X5H4_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctcccc
A0A0B6VHG4_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2H4Z4D6_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7U1E2_BHRF1-0      tgcatc-------ctgtgttgga-gctagcatcaagagaaacacctctcc
A0A2S1N3G0_BHRF1-0      tgcatc-------ctgtgttgga-gctagcatcaagagaaacacctctcc
V5KUE2_BHRF1-02         tgcatc-------ctgtgttgga-gctagcatcaagagaaacacctctcc
A0A4D6TWZ3_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A385J9R2_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7T924_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7T6R4_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A385J8Q6_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctct
A0A4D6TV66_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacgtctct
A0A0C7T306_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacatctcc
A0A385J7D0_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacttctcc
A0A4D6R3D4_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0X9C4Q9_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0X8YIW3_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcgagagaaacacctctcc
A0A4D6QKL8_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A3R5TRD4_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A385J922_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2H4Z4F8_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2H4Z4E3_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2H4Z4D9_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
K9UTF7_BHRF1-01         tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7TWM2_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2D1LYW3_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7TK05_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
P03182_BHRF1-01         tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A410I865_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A385JAL1_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2S1N3U3_BHRF1-0      tgcatc-------ctgtgttgga-gctagcaacaagagaaacacctctcc
A0A2S1MNB9_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A2S1MMY2_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaatcacctctcc
A0A0S2YRE8_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7TX82_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7TTN2_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7TNT4_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
A0A0C7SXB3_BHRF1-0      tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
K9UTN7_BHRF1-01         tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
V5KU29_BHRF1-02         tgcatc-------ctgtgttgga-gctagcagcaagagaaacacctctcc
                                                                          

P90504_ORF16-01         -------g-------------------------aggccatgttggctaat
F5HGJ3_ORF16-01         -------g-------------------------aggccatgttggctaat
Q76RI8_ORF16-01         -------g-------------------------aggccatgttggctaat
Q99F66_BALF1-01         -------cccagctc-------------ag---gtcctgtgccggctcat
A0A4D6QN24_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A385JB67_BALF1-0      -------gccagccc-------------tg---gtcctctgccggcncan
A0A4D6R4T3_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A385J7X7_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A0C7TV67_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1N1Z2_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1N2H2_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A4D6TWI9_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A4D6R8R0_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A3R5WV36_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A4D6RFR1_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A4D6RC31_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A4D6RBY3_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A3R5WYW3_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A3R5WNA2_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A075FFB0_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A075FCZ0_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A410I1F1_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
U5YUM6_BALF1-01         -------gccagccc-------------tg---gtcctctgccggctcat
A0A4D6RE52_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A7G1IXW1_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A0A8IKW4_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A4D6R8J3_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1MZQ8_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A385JAB4_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A4D6QXN1_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A4D6QMD2_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A410J0D8_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A410I9N0_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A3R5ZJV6_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A3R5WKR1_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A0U3UKR9_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2D1LYV4_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
Q91HV2_BALF1-01         -------gccagccc-------------tg---gtcctctgccggctcat
A0A0C7TPI3_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1MQV1_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A0C7T8J1_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1MP06_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1MXY9_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A0S2YQW9_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A0C7TJ32_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A385J8K7_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1MV59_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1MU91_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1MM94_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A0U3U737_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A0C7TLW1_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A1P7TZL6_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
K9UT94_BALF1-01         -------gccagccc-------------tg---gtcctctgccggctcat
P0CK58_BALF1-01         -------gccagccc-------------tg---gtcctctgccggctcat
P0CK59_BALF1-01         -------gccagccc-------------tg---gtcctctgccggctcat
A0A0C7TUX3_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
A0A2S1MTH2_BALF1-0      -------gccagccc-------------tg---gtcctctgccggctcat
Q91HI3_BALF1-01         -------gccagcca-------------tg---gtcctgtgccggctgat
Q99F65_BALF1-01         -------gccggccg-------------cg---gtcctgtgccggctgat
H3ALX7_vNR13-01         -------g---actcgtt-tcaggggaact---gtgggccggaggc----
Q9DH00_vNR13-01         -------c---gctc-------------ct---gcgcgccgttag-----
Q9DH00_vNR13-02         -------c---gctc-------------ct---gcgcgccgttag-----
A0A8C7EHJ2_vNR13-0      -------c---gctc-------------gt---gcgccgcgctggcgcgg
A0A8C2U8D6_vNR13-0      -------c---gatc-------------ct---gcgctccgctggcgcgg
Q90343_vNR13-01         -------c---gatc-------------ct---gcgctccgctggcgcgg
A0A674GY73_vNR13-0      -------c---gctc-------------ct---gcgcgccgctggcgcgg
A0A8C3KMB5_vNR13-0      -------c---gctc-------------ct---gcgcgccgctggcccgg
A0A8D0KT43_vNR13-0      -------c---gctc-------------ct---gcgcgccgctggcgcgg
A0A663ECE3_vNR13-0      -------c---gctc-------------ct---gcgcgccgctggcgcgg
A0A8C4V604_vNR13-0      -------c---gctc-------------ct---gcgcgccgctggcgcgg
A0A8B9GHZ4_vNR13-0      -------c---gctc-------------ct---gcgcgccgctggcgcgg
A0A672TYX3_vNR13-0      -------c---gctc-------------ct---gcgcgccgctggcgcgg
A0A8C5RRS8_vNR13-0      -------cgcaacgc-------------ct---gcagcgccgccgctttg
A0A8C6YHI4_vNR13-0      -------cgcaacgc-------------ct---gcagcgccgccgctttg
A0A8D0KNJ6_vNR13-0      -------cgcagcgc-------------ctgcagcagcgcgggcgccctg
A0A670KGT8_vNR13-0      -------cgcagcgc-------------ct---gcacggcggccgccttg
A0A8D2LWG1_vNR13-0      -------cgcgacgc-------------ct---gcggcgcggcggccgcg
A0A8D0L3Y5_vNR13-0      -------cgcagcgc-------------ct---gccgcccgctggccctg
A0A8C8VNX1_vNR13-0      -------c---gcgc-------------ct---gccgcccgctggccctg
A0A8C3SNB5_vNR13-0      -------c---gcgc-------------ct---gccgcccgctggccctg
A0A8C4VQB8_vNR13-0      -------c---gcgc-------------ct---gccgcccgctggccctg
A0A8C3IX63_vNR13-0      -------c---gcgc-------------ct---gccgcccgctggccctg
A0A674KEW6_vNR13-0      -------c---gcgc-------------ct---gccgcccgctggccctg
A1BM64_A9-01            caggaaggcattcaatgacggggacctgctttactt--------------
Q2VSG7_A9-01            caggaaggcattcaatgacggggacctgctttactt--------------
A0A1L2JVL1_A9-01        -------gcagccacgca-aa-------------------gttaatactt
O36423_A9-01            -------gcagccacgca-aa-------------------gttaatactt
Q1XBS8_VBCL2-01         -------gacactgaaca-cgagccttactctaat-ctgtgtgaaaactt
Q1XBS6_VBCL2-01         -------gacactgaaca-cgagccttactccaat-ctgtgtgaaaactt
Q1XBS7_VBCL2-01         -------gacactgaaca-cgagccttactccaat-ctgtgtgaaaactt
Q99D15_VBCL2-01         -------gacactgaaca-cgagccttactccaat-ctgtgtaaaaactt
Q9WH78_VBCL2-01         -------gacactgaaca-cgagccttactccaat-ctgtgtaaaaactt
P89884_M11-01           -------ccaggagttta-gaaggc--actatgaca------------gc
B1PZP0_M11-01           -------ccaggagttta-gaaggc--actatgaca------------gc
A0A6M4EIA3_M11-01       -------ccaggagttta-gaaggc--actatgaca------------gc
D0U1R1_M11-01           -------tcaagagttca-gaagtc--actatgaca------------gt
Q9Q5K8_BHRF1-01         -------gcgtttctcct-ggcgac--cctctggttctgcgtttacatgc
Q9WGB5_BHRF1-01         -------gcgtttctcct-ggcgac--cctctggttctgcgtttacatgc
A0A0S0DHY9_BHRF1-0      -------gcctctctgcg-ggggac--actctggttttacgtgtccatgt
Q8UZJ4_BHRF1-01         -------gcctctctgcg-ggggac--actctggttctacgtgtccatgt
Q9IHR2_BHRF1-01         -------gcgtttcccca-gaagat--actgtggttttgcggttacattt
A0A0S2YQS0_BHRF1-0      -------gcgtttcgcca-gaggac--actgtagtgctgcgttatcatgt
A0A2H4Z4F2_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A2S1N164_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2S1MYK7_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A410IGR6_BHRF1-0      -------acctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A4D6QZG6_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A2H4Z4C5_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A2S1MW70_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A3R5TSC7_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A451G5Y6_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A3R5U6U7_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A2S1MWX4_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A2S1MX38_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A451G617_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A4D6QS84_BHRF1-0      -------gcctttcacca-gaggac--actgtagttctgcgttatcatgt
A0A4D6R7N0_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2H4Z4M5_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2H4Z4H8_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2H4Z4I4_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7TQI4_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A3R5UEL7_BHRF1-0      -------gcctttcgcca-gaggac--actatagttctgcgttatcatgt
A0A2H4Z4I0_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A3R5X5H4_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0B6VHG4_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2H4Z4D6_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7U1E2_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2S1N3G0_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
V5KUE2_BHRF1-02         -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A4D6TWZ3_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A385J9R2_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7T924_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7T6R4_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A385J8Q6_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A4D6TV66_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7T306_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A385J7D0_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A4D6R3D4_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0X9C4Q9_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0X8YIW3_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A4D6QKL8_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A3R5TRD4_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A385J922_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2H4Z4F8_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2H4Z4E3_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2H4Z4D9_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
K9UTF7_BHRF1-01         -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7TWM2_BHRF1-0      -------gccttttgcca-gaggac--actgtagttctgcgttatcatgt
A0A2D1LYW3_BHRF1-0      -------gccttttgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7TK05_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
P03182_BHRF1-01         -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A410I865_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A385JAL1_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2S1N3U3_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2S1MNB9_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A2S1MMY2_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0S2YRE8_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7TX82_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7TTN2_BHRF1-0      -------acctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7TNT4_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
A0A0C7SXB3_BHRF1-0      -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
K9UTN7_BHRF1-01         -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
V5KU29_BHRF1-02         -------gcctttcgcca-gaggac--actgtagttctgcgttatcatgt
                                                                          

P90504_ORF16-01         g-----------tgagat--------------------tt--------ca
F5HGJ3_ORF16-01         g-----------tgagat--------------------tt--------ca
Q76RI8_ORF16-01         g-----------tgagat--------------------tt--------ca
Q99F66_BALF1-01         ------------caa---------------------------------gg
A0A4D6QN24_BALF1-0      ------------caa---------------------------------gg
A0A385JB67_BALF1-0      ------------caa---------------------------------gg
A0A4D6R4T3_BALF1-0      ------------caa---------------------------------gg
A0A385J7X7_BALF1-0      ------------caa---------------------------------gg
A0A0C7TV67_BALF1-0      ------------caa---------------------------------gg
A0A2S1N1Z2_BALF1-0      ------------caa---------------------------------gg
A0A2S1N2H2_BALF1-0      ------------caa---------------------------------gg
A0A4D6TWI9_BALF1-0      ------------caa---------------------------------gg
A0A4D6R8R0_BALF1-0      ------------caa---------------------------------gg
A0A3R5WV36_BALF1-0      ------------caa---------------------------------gg
A0A4D6RFR1_BALF1-0      ------------caa---------------------------------gg
A0A4D6RC31_BALF1-0      ------------caa---------------------------------gg
A0A4D6RBY3_BALF1-0      ------------caa---------------------------------gg
A0A3R5WYW3_BALF1-0      ------------caa---------------------------------gg
A0A3R5WNA2_BALF1-0      ------------caa---------------------------------gg
A0A075FFB0_BALF1-0      ------------caa---------------------------------gg
A0A075FCZ0_BALF1-0      ------------caa---------------------------------gg
A0A410I1F1_BALF1-0      ------------caa---------------------------------gg
U5YUM6_BALF1-01         ------------caa---------------------------------gg
A0A4D6RE52_BALF1-0      ------------caa---------------------------------gg
A0A7G1IXW1_BALF1-0      ------------caa---------------------------------gg
A0A0A8IKW4_BALF1-0      ------------caa---------------------------------gg
A0A4D6R8J3_BALF1-0      ------------caa---------------------------------gg
A0A2S1MZQ8_BALF1-0      ------------caa---------------------------------gg
A0A385JAB4_BALF1-0      ------------caa---------------------------------gg
A0A4D6QXN1_BALF1-0      ------------caa---------------------------------gg
A0A4D6QMD2_BALF1-0      ------------caa---------------------------------gg
A0A410J0D8_BALF1-0      ------------caa---------------------------------gg
A0A410I9N0_BALF1-0      ------------caa---------------------------------gg
A0A3R5ZJV6_BALF1-0      ------------caa---------------------------------gg
A0A3R5WKR1_BALF1-0      ------------caa---------------------------------gg
A0A0U3UKR9_BALF1-0      ------------caa---------------------------------gg
A0A2D1LYV4_BALF1-0      ------------caa---------------------------------gg
Q91HV2_BALF1-01         ------------caa---------------------------------gg
A0A0C7TPI3_BALF1-0      ------------caa---------------------------------gg
A0A2S1MQV1_BALF1-0      ------------caa---------------------------------gg
A0A0C7T8J1_BALF1-0      ------------caa---------------------------------gg
A0A2S1MP06_BALF1-0      ------------caa---------------------------------gg
A0A2S1MXY9_BALF1-0      ------------caa---------------------------------gg
A0A0S2YQW9_BALF1-0      ------------caa---------------------------------gg
A0A0C7TJ32_BALF1-0      ------------caa---------------------------------gg
A0A385J8K7_BALF1-0      ------------caa---------------------------------gg
A0A2S1MV59_BALF1-0      ------------caa---------------------------------gg
A0A2S1MU91_BALF1-0      ------------caa---------------------------------gg
A0A2S1MM94_BALF1-0      ------------caa---------------------------------gg
A0A0U3U737_BALF1-0      ------------caa---------------------------------gg
A0A0C7TLW1_BALF1-0      ------------caa---------------------------------gg
A0A1P7TZL6_BALF1-0      ------------caa---------------------------------gg
K9UT94_BALF1-01         ------------caa---------------------------------gg
P0CK58_BALF1-01         ------------caa---------------------------------gg
P0CK59_BALF1-01         ------------caa---------------------------------gg
A0A0C7TUX3_BALF1-0      ------------caa---------------------------------gg
A0A2S1MTH2_BALF1-0      ------------caa---------------------------------gg
Q91HI3_BALF1-01         ------------taa---------------------------------gg
Q99F65_BALF1-01         ------------caa---------------------------------gg
H3ALX7_vNR13-01         ------------cgagct--------------------c---------gg
Q9DH00_vNR13-01         ------------cgagcg--------------------gcggcacgcagg
Q9DH00_vNR13-02         ------------cgagcg--------------------gcggcacgcagg
A0A8C7EHJ2_vNR13-0      g-------c---cgagcc--------------------ctgggaggc-cg
A0A8C2U8D6_vNR13-0      g-------c---cgagcc--------------------gcgggaggc-gg
Q90343_vNR13-01         g-------c---cgagcc--------------------gcgggaggc-gg
A0A674GY73_vNR13-0      g-------c---cgagcc--------------------gcgggaggc-gg
A0A8C3KMB5_vNR13-0      g-------c---cgagcc--------------------gcgggaggc-gg
A0A8D0KT43_vNR13-0      g-------c---cgagcc--------------------gcgggaggc-gg
A0A663ECE3_vNR13-0      g-------c---cgagcc--------------------gcgggaggc-gg
A0A8C4V604_vNR13-0      g-------c---cgagcc--------------------gcgggaggc-gg
A0A8B9GHZ4_vNR13-0      g-------c---cgagcc--------------------gcaggaagc-ga
A0A672TYX3_vNR13-0      g-------c---cgagcc--------------------gcaggaggc-ga
A0A8C5RRS8_vNR13-0      c-------c---cgagcc--------------------cggcgaggc-gg
A0A8C6YHI4_vNR13-0      c-------c---cgagcc--------------------cggcgaggc-gg
A0A8D0KNJ6_vNR13-0      c-------cggaggagcc--------------------gggcgaggc-gg
A0A670KGT8_vNR13-0      c-------cgcaggagcc--------------------gggcgaggc-gg
A0A8D2LWG1_vNR13-0      g-------c---ggagcc--------------------gggcgaggc-gg
A0A8D0L3Y5_vNR13-0      g-------c---cgagcc--------------------cggggagcc-ag
A0A8C8VNX1_vNR13-0      g-------a---cgagcg--------------------ccgggagcc-gg
A0A8C3SNB5_vNR13-0      g-------a---cgagcg--------------------ccgggaccc-gg
A0A8C4VQB8_vNR13-0      g-------a---cgagcg--------------------ccgggagcc-gg
A0A8C3IX63_vNR13-0      g-------a---cgagcg--------------------ccgggagcc-gg
A0A674KEW6_vNR13-0      g-------a---cgagcg--------------------ccgggagcc-gg
A1BM64_A9-01            -------taacttcactagagagatacacatgctccttataaagagcggc
Q2VSG7_A9-01            -------taacttcactagagagatacacatgctccttataaagagcggc
A0A1L2JVL1_A9-01        g-------------------------------------atgaaacccgga
O36423_A9-01            g-------------------------------------atgaaacccgga
Q1XBS8_VBCL2-01         gataaccatggccgagcaggacatggatgaggtggtctccacaatcagga
Q1XBS6_VBCL2-01         gataaccatggccgagcaggacatggatgaggtggtctccacaatcagga
Q1XBS7_VBCL2-01         gataaccatggccgagcaggacatggatgaggtggtctccacaatcagga
Q99D15_VBCL2-01         gataaccatggccgagcaggacatggatgaggtggtctccacaatcagga
Q9WH78_VBCL2-01         gataaccatggccgagcaggacatggatgaggtggtctccacaatcagga
P89884_M11-01           g------tttaccgcgcggattatggc-----------cctgccctcaag
B1PZP0_M11-01           g------tttaccgcgcggattatggc-----------cctgccctcaag
A0A6M4EIA3_M11-01       g------tttaccgcgcggattatggc-----------cctgccctcaag
D0U1R1_M11-01           g------tcttccatatggattatggc-----------cctgcccttcaa
Q9Q5K8_BHRF1-01         g------ctacttgagcagataattgt-----------ccagaatgagga
Q9WGB5_BHRF1-01         g------ctacttgagcaaataattgt-----------ccagaatgagga
A0A0S0DHY9_BHRF1-0      a------ctgcttgagcaaataattga-----------acaaaacgcggg
Q8UZJ4_BHRF1-01         a------ctgcttgagcaaataattga-----------acaaaatgcggg
Q9IHR2_BHRF1-01         g------ttgcttgaggaggtaattca-----------gcaaaatgcaga
A0A0S2YQS0_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4F2_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2S1N164_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2S1MYK7_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A410IGR6_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A4D6QZG6_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4C5_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2S1MW70_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A3R5TSC7_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A451G5Y6_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A3R5U6U7_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2S1MWX4_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2S1MX38_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A451G617_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A4D6QS84_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A4D6R7N0_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4M5_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4H8_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4I4_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7TQI4_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A3R5UEL7_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4I0_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A3R5X5H4_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0B6VHG4_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4D6_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7U1E2_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2S1N3G0_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
V5KUE2_BHRF1-02         g------ttgcttgaggagataattga-----------acgaaattcaga
A0A4D6TWZ3_BHRF1-0      g------ttgctcgaggagataattga-----------acgaaattcaga
A0A385J9R2_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7T924_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7T6R4_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A385J8Q6_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A4D6TV66_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7T306_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A385J7D0_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A4D6R3D4_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0X9C4Q9_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0X8YIW3_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A4D6QKL8_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A3R5TRD4_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A385J922_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4F8_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4E3_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2H4Z4D9_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
K9UTF7_BHRF1-01         g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7TWM2_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2D1LYW3_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7TK05_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
P03182_BHRF1-01         g------ttgcttgaggagataattga-----------acgaaattcaga
A0A410I865_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A385JAL1_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2S1N3U3_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2S1MNB9_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A2S1MMY2_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0S2YRE8_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7TX82_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7TTN2_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7TNT4_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
A0A0C7SXB3_BHRF1-0      g------ttgcttgaggagataattga-----------acgaaattcaga
K9UTN7_BHRF1-01         g------ttgcttgaggagataattga-----------acgaaattcaga
V5KU29_BHRF1-02         g------ttgcttgaggagataattga-----------acgaaattcaga
                                                                          

P90504_ORF16-01         cagcaccaccggtataaaccagc---------------------------
F5HGJ3_ORF16-01         cagcaccaccggtataaaccagc---------------------------
Q76RI8_ORF16-01         cagcaccaccggtataaaccagc---------------------------
Q99F66_BALF1-01         cctccctcagaaaggacaagaaa---------------------------
A0A4D6QN24_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A385JB67_BALF1-0      ccnccctgaggaaggataggaag---------------------------
A0A4D6R4T3_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A385J7X7_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A0C7TV67_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2S1N1Z2_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2S1N2H2_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A4D6TWI9_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A4D6R8R0_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A3R5WV36_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A4D6RFR1_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A4D6RC31_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A4D6RBY3_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A3R5WYW3_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A3R5WNA2_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A075FFB0_BALF1-0      cctccctgaggaaggataggagg---------------------------
A0A075FCZ0_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A410I1F1_BALF1-0      cctccctgaggaaggataggaag---------------------------
U5YUM6_BALF1-01         cctccctgaggaaggataggaag---------------------------
A0A4D6RE52_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A7G1IXW1_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A0A8IKW4_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A4D6R8J3_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2S1MZQ8_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A385JAB4_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A4D6QXN1_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A4D6QMD2_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A410J0D8_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A410I9N0_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A3R5ZJV6_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A3R5WKR1_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A0U3UKR9_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2D1LYV4_BALF1-0      cctccctgaggaaggataggaag---------------------------
Q91HV2_BALF1-01         cctccctgaggaaggataggaag---------------------------
A0A0C7TPI3_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2S1MQV1_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A0C7T8J1_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2S1MP06_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2S1MXY9_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A0S2YQW9_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A0C7TJ32_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A385J8K7_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2S1MV59_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2S1MU91_BALF1-0      cctccctgaggaaggatagggag---------------------------
A0A2S1MM94_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A0U3U737_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A0C7TLW1_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A1P7TZL6_BALF1-0      cctccctgaggaaggataggaag---------------------------
K9UT94_BALF1-01         cctccctgaggaaggataggaag---------------------------
P0CK58_BALF1-01         cctccctgaggaaggataggaag---------------------------
P0CK59_BALF1-01         cctccctgaggaaggataggaag---------------------------
A0A0C7TUX3_BALF1-0      cctccctgaggaaggataggaag---------------------------
A0A2S1MTH2_BALF1-0      cctccctgaggaaggataggaag---------------------------
Q91HI3_BALF1-01         cgtccctgaagaaggacaagaag---------------------------
Q99F65_BALF1-01         cctccctgaagaaggacagaaag---------------------------
H3ALX7_vNR13-01         ct-cggtgctgaaga------gg---------------------------
Q9DH00_vNR13-01         cagcgttgtcggcgctgcaaagt---------------------------
Q9DH00_vNR13-02         cagcgttgtcggcgctgcaaagt---------------------------
A0A8C7EHJ2_vNR13-0      cggcgctgctggcgc------gc---------------------------
A0A8C2U8D6_vNR13-0      cggcgctgctgcgga------ag---------------------------
Q90343_vNR13-01         cggcgctgctgcgga------ag---------------------------
A0A674GY73_vNR13-0      ccgcgctgctgggca------gg---------------------------
A0A8C3KMB5_vNR13-0      cggcgctgctgaggc------gg---------------------------
A0A8D0KT43_vNR13-0      cggcgctgctggagc------gg---------------------------
A0A663ECE3_vNR13-0      cggcgctgctggagc------gg---------------------------
A0A8C4V604_vNR13-0      cggcgctgctggcgc------gg---------------------------
A0A8B9GHZ4_vNR13-0      cggcgctgctggagc------gg---------------------------
A0A672TYX3_vNR13-0      cggcgctgctggggc------gg---------------------------
A0A8C5RRS8_vNR13-0      cggctttgctgggcc------gg---------------------------
A0A8C6YHI4_vNR13-0      cggctttgctgggcc------gg---------------------------
A0A8D0KNJ6_vNR13-0      ctgcgctcctgagcc------gg---------------------------
A0A670KGT8_vNR13-0      ccgcgctgctgggcc------gg---------------------------
A0A8D2LWG1_vNR13-0      ccgcgctgctgggcc------gg---------------------------
A0A8D0L3Y5_vNR13-0      ccgccctcctggccc------gg---------------------------
A0A8C8VNX1_vNR13-0      cggcgctgctggccc------gg---------------------------
A0A8C3SNB5_vNR13-0      cggcgctgctgagcc------gg---------------------------
A0A8C4VQB8_vNR13-0      cggcgctgctgagcc------gc---------------------------
A0A8C3IX63_vNR13-0      cggcgctgctgagcc------gg---------------------------
A0A674KEW6_vNR13-0      cggcgctgctgagcc------gg---------------------------
A1BM64_A9-01            attccctgtagctatgctaaaggcatc-----------------------
Q2VSG7_A9-01            attccctgtagctatgctaaaggcatc-----------------------
A0A1L2JVL1_A9-01        ag-------aggggcctcgagtgcagt-----------------------
O36423_A9-01            ag-------aggggcctcgagtgcagt-----------------------
Q1XBS8_VBCL2-01         ggctcttggtggaatgtggtatgggattggaagaatatttagaccatccc
Q1XBS6_VBCL2-01         ggctcttggtggaatgtggtatgggattggaagaatatttagaccatccc
Q1XBS7_VBCL2-01         ggctcttggtggaatgtggtatgggattggaagaatatttagaacaccct
Q99D15_VBCL2-01         ggctcttggtggaatgtggtatgggattggaagaatatttagaacaccct
Q9WH78_VBCL2-01         ggctcttggtggaatgtggtatgggattggaagaatatttagaacaccct
P89884_M11-01           aactggaaaagagacct-gtccaaact-----------------------
B1PZP0_M11-01           aactggaaaagagacct-gtccaaact-----------------------
A0A6M4EIA3_M11-01       aactggaaaagagacct-gtccaaact-----------------------
D0U1R1_M11-01           aactggaaagggggcct-ggctagact-----------------------
Q9Q5K8_BHRF1-01         tgcctttgcagagactttggtcacattt----------------------
Q9WGB5_BHRF1-01         tgcctttgcagagactttggacagattt----------------------
A0A0S0DHY9_BHRF1-0      tgccttttcagaagccttggacagattt----------------------
Q8UZJ4_BHRF1-01         tgcctttttagaagccttggacagattt----------------------
Q9IHR2_BHRF1-01         atcatttacaaacacttgggagacattt----------------------
A0A0S2YQS0_BHRF1-0      tacatttacagaaacttgggacagattt----------------------
A0A2H4Z4F2_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2S1N164_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2S1MYK7_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A410IGR6_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A4D6QZG6_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2H4Z4C5_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2S1MW70_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A3R5TSC7_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A451G5Y6_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A3R5U6U7_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2S1MWX4_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2S1MX38_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A451G617_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A4D6QS84_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A4D6R7N0_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2H4Z4M5_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2H4Z4H8_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2H4Z4I4_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7TQI4_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A3R5UEL7_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2H4Z4I0_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A3R5X5H4_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0B6VHG4_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2H4Z4D6_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7U1E2_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2S1N3G0_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
V5KUE2_BHRF1-02         gacatttacagaaacttggaacagattt----------------------
A0A4D6TWZ3_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A385J9R2_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7T924_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7T6R4_BHRF1-0      gacattttcagaaacttggaacagattt----------------------
A0A385J8Q6_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A4D6TV66_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7T306_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A385J7D0_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A4D6R3D4_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0X9C4Q9_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0X8YIW3_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A4D6QKL8_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A3R5TRD4_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A385J922_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2H4Z4F8_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2H4Z4E3_BHRF1-0      gacatttacagaaacttggaacagtttt----------------------
A0A2H4Z4D9_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
K9UTF7_BHRF1-01         gacatttacagaaacttggaacagattt----------------------
A0A0C7TWM2_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2D1LYW3_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7TK05_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
P03182_BHRF1-01         gacatttacagaaacttggaacagattt----------------------
A0A410I865_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A385JAL1_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2S1N3U3_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2S1MNB9_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A2S1MMY2_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0S2YRE8_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7TX82_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7TTN2_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7TNT4_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
A0A0C7SXB3_BHRF1-0      gacatttacagaaacttggaacagattt----------------------
K9UTN7_BHRF1-01         gacatttacagaaacttggaacagattt----------------------
V5KU29_BHRF1-02         gacatttacagaaacttggaacagattt----------------------
                                                                          

P90504_ORF16-01         --------------------------------------------------
F5HGJ3_ORF16-01         --------------------------------------------------
Q76RI8_ORF16-01         --------------------------------------------------
Q99F66_BALF1-01         --------------------------------------------------
A0A4D6QN24_BALF1-0      --------------------------------------------------
A0A385JB67_BALF1-0      --------------------------------------------------
A0A4D6R4T3_BALF1-0      --------------------------------------------------
A0A385J7X7_BALF1-0      --------------------------------------------------
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      --------------------------------------------------
A0A2S1N2H2_BALF1-0      --------------------------------------------------
A0A4D6TWI9_BALF1-0      --------------------------------------------------
A0A4D6R8R0_BALF1-0      --------------------------------------------------
A0A3R5WV36_BALF1-0      --------------------------------------------------
A0A4D6RFR1_BALF1-0      --------------------------------------------------
A0A4D6RC31_BALF1-0      --------------------------------------------------
A0A4D6RBY3_BALF1-0      --------------------------------------------------
A0A3R5WYW3_BALF1-0      --------------------------------------------------
A0A3R5WNA2_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A410I1F1_BALF1-0      --------------------------------------------------
U5YUM6_BALF1-01         --------------------------------------------------
A0A4D6RE52_BALF1-0      --------------------------------------------------
A0A7G1IXW1_BALF1-0      --------------------------------------------------
A0A0A8IKW4_BALF1-0      --------------------------------------------------
A0A4D6R8J3_BALF1-0      --------------------------------------------------
A0A2S1MZQ8_BALF1-0      --------------------------------------------------
A0A385JAB4_BALF1-0      --------------------------------------------------
A0A4D6QXN1_BALF1-0      --------------------------------------------------
A0A4D6QMD2_BALF1-0      --------------------------------------------------
A0A410J0D8_BALF1-0      --------------------------------------------------
A0A410I9N0_BALF1-0      --------------------------------------------------
A0A3R5ZJV6_BALF1-0      --------------------------------------------------
A0A3R5WKR1_BALF1-0      --------------------------------------------------
A0A0U3UKR9_BALF1-0      --------------------------------------------------
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         --------------------------------------------------
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      --------------------------------------------------
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      --------------------------------------------------
A0A2S1MXY9_BALF1-0      --------------------------------------------------
A0A0S2YQW9_BALF1-0      --------------------------------------------------
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A385J8K7_BALF1-0      --------------------------------------------------
A0A2S1MV59_BALF1-0      --------------------------------------------------
A0A2S1MU91_BALF1-0      --------------------------------------------------
A0A2S1MM94_BALF1-0      --------------------------------------------------
A0A0U3U737_BALF1-0      --------------------------------------------------
A0A0C7TLW1_BALF1-0      --------------------------------------------------
A0A1P7TZL6_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         --------------------------------------------------
P0CK59_BALF1-01         --------------------------------------------------
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      --------------------------------------------------
Q91HI3_BALF1-01         --------------------------------------------------
Q99F65_BALF1-01         --------------------------------------------------
H3ALX7_vNR13-01         --------------------------------------------------
Q9DH00_vNR13-01         --------------------------------------------------
Q9DH00_vNR13-02         --------------------------------------------------
A0A8C7EHJ2_vNR13-0      --------------------------------------------------
A0A8C2U8D6_vNR13-0      --------------------------------------------------
Q90343_vNR13-01         --------------------------------------------------
A0A674GY73_vNR13-0      --------------------------------------------------
A0A8C3KMB5_vNR13-0      --------------------------------------------------
A0A8D0KT43_vNR13-0      --------------------------------------------------
A0A663ECE3_vNR13-0      --------------------------------------------------
A0A8C4V604_vNR13-0      --------------------------------------------------
A0A8B9GHZ4_vNR13-0      --------------------------------------------------
A0A672TYX3_vNR13-0      --------------------------------------------------
A0A8C5RRS8_vNR13-0      --------------------------------------------------
A0A8C6YHI4_vNR13-0      --------------------------------------------------
A0A8D0KNJ6_vNR13-0      --------------------------------------------------
A0A670KGT8_vNR13-0      --------------------------------------------------
A0A8D2LWG1_vNR13-0      --------------------------------------------------
A0A8D0L3Y5_vNR13-0      --------------------------------------------------
A0A8C8VNX1_vNR13-0      --------------------------------------------------
A0A8C3SNB5_vNR13-0      --------------------------------------------------
A0A8C4VQB8_vNR13-0      --------------------------------------------------
A0A8C3IX63_vNR13-0      --------------------------------------------------
A0A674KEW6_vNR13-0      --------------------------------------------------
A1BM64_A9-01            atgagagctgccaggacaaaagc---cgtggactgcagctcc--------
Q2VSG7_A9-01            atgagagccgccaggacaaaagc---cgtggactgcagctcc--------
A0A1L2JVL1_A9-01        --------------------ggg---------------------------
O36423_A9-01            --------------------ggg---------------------------
Q1XBS8_VBCL2-01         gtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaaca
Q1XBS6_VBCL2-01         gtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaaca
Q1XBS7_VBCL2-01         gtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaaca
Q99D15_VBCL2-01         gtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaaca
Q9WH78_VBCL2-01         gtaacagcccccataaaggtggctgtccaggatgtgatcagaacaaaaca
P89884_M11-01           --------------------------------tttcacctcg--------
B1PZP0_M11-01           --------------------------------tttcacctcg--------
A0A6M4EIA3_M11-01       --------------------------------tttcacctcg--------
D0U1R1_M11-01           --------------------------------ttttacctca--------
Q9Q5K8_BHRF1-01         ctcttgaacactgaagacctgga---cctggatttttccaga--------
Q9WGB5_BHRF1-01         ctcttgaacactgaagacctgga---cctggatttttccaga--------
A0A0S0DHY9_BHRF1-0      ttatcaaacaccgaagcgtggga---tgtggattttaccaga--------
Q8UZJ4_BHRF1-01         ttatcaaacaccgaagagtggga---tgtggattttaccaga--------
Q9IHR2_BHRF1-01         ataacaaacgctgaacacgtgga---cctggattttgccgct--------
A0A0S2YQS0_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A2H4Z4F2_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A2S1N164_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A2S1MYK7_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A410IGR6_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A4D6QZG6_BHRF1-0      ataacacacaccgaaaatttgga---cctggattttaactca--------
A0A2H4Z4C5_BHRF1-0      ataacacacaccgatcatttgga---cctggattttaactca--------
A0A2S1MW70_BHRF1-0      ataacacacaccggacatttgga---cctggattttaactca--------
A0A3R5TSC7_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A451G5Y6_BHRF1-0      ataacatacaccgaacatttgga---cctggattttaactca--------
A0A3R5U6U7_BHRF1-0      atgacacacaccgaacatttgga---cctggattttaactca--------
A0A2S1MWX4_BHRF1-0      acaacacacaccgaacatttgga---cctggattttaactca--------
A0A2S1MX38_BHRF1-0      ttaacacacaccgaacatttgga---cctggattttaactca--------
A0A451G617_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A4D6QS84_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A4D6R7N0_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A2H4Z4M5_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A2H4Z4H8_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A2H4Z4I4_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A0C7TQI4_BHRF1-0      ataacacacaccgaaaatttgga---cctggattttaactca--------
A0A3R5UEL7_BHRF1-0      ataacacacaccgaaaatttgga---cctggattttaactca--------
A0A2H4Z4I0_BHRF1-0      ataacacacaccgaacatttgga---cctggattttaactca--------
A0A3R5X5H4_BHRF1-0      ataacacacaccgaaaatttgga---cctggattttaactca--------
A0A0B6VHG4_BHRF1-0      ataacacacaccgaaaatttgga---cctggattttaactca--------
A0A2H4Z4D6_BHRF1-0      ataacacacaccgcaaatttgga---cctggattttaactca--------
A0A0C7U1E2_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaattca--------
A0A2S1N3G0_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaattca--------
V5KUE2_BHRF1-02         ataacacacaccgaacatgtgga---cctggattttaattca--------
A0A4D6TWZ3_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A385J9R2_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0C7T924_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0C7T6R4_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A385J8Q6_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A4D6TV66_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0C7T306_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A385J7D0_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A4D6R3D4_BHRF1-0      ataagacacaccgaacatttgga---cctggattttaactca--------
A0A0X9C4Q9_BHRF1-0      ataagacacaccgaacatttgga---cctggattttaactca--------
A0A0X8YIW3_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A4D6QKL8_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A3R5TRD4_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A385J922_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A2H4Z4F8_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A2H4Z4E3_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A2H4Z4D9_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
K9UTF7_BHRF1-01         ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0C7TWM2_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A2D1LYW3_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0C7TK05_BHRF1-0      ataacacacaccgaacatgtgga---tctggattttaactca--------
P03182_BHRF1-01         ataacacacaccgaacatgtgga---tctggattttaactca--------
A0A410I865_BHRF1-0      ataacacacaccgaacatatgga---cctggattttaactca--------
A0A385JAL1_BHRF1-0      ataacatacaccgaacatgtgga---cctggattttaactca--------
A0A2S1N3U3_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A2S1MNB9_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A2S1MMY2_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0S2YRE8_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0C7TX82_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0C7TTN2_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0C7TNT4_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
A0A0C7SXB3_BHRF1-0      ataacacacaccgaacatgtgga---cctggattttaactca--------
K9UTN7_BHRF1-01         ataacacacaccgaacatgtgga---cctggattttaactca--------
V5KU29_BHRF1-02         ataacacacaccgaacatgtgga---cctggattttaactca--------
                                                                          

P90504_ORF16-01         --ttgggttgagcatgctgcaggttagcgg-------------cgatgga
F5HGJ3_ORF16-01         --ttgggttgagcatgctgcaggttagcgg-------------cgatgga
Q76RI8_ORF16-01         --ttgggttgagcatgctgcaggttagcgg-------------cgatgga
Q99F66_BALF1-01         --ctgt--------acgcggagctggcctg-------------c-aagac
A0A4D6QN24_BALF1-0      --ctat--------acgcagagctcgcctg-------------c-aggac
A0A385JB67_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A4D6R4T3_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A385J7X7_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A0C7TV67_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A2S1N1Z2_BALF1-0      --ctgt--------acacggagctggcctg-------------c-aggac
A0A2S1N2H2_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A4D6TWI9_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A4D6R8R0_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A3R5WV36_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A4D6RFR1_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A4D6RC31_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A4D6RBY3_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A3R5WYW3_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A3R5WNA2_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A075FFB0_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A075FCZ0_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A410I1F1_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
U5YUM6_BALF1-01         --ctgt--------acgcagagctggcctg-------------c-aggac
A0A4D6RE52_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A7G1IXW1_BALF1-0      --ctgt--------acgcaaagctggcctg-------------c-aggac
A0A0A8IKW4_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A4D6R8J3_BALF1-0      --ctgt--------acgcagagctggcctg-------------c-aggac
A0A2S1MZQ8_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A385JAB4_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A4D6QXN1_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A4D6QMD2_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A410J0D8_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A410I9N0_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A3R5ZJV6_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A3R5WKR1_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A0U3UKR9_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A2D1LYV4_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
Q91HV2_BALF1-01         --ctgt--------acgcggagctggcctg-------------c-aggac
A0A0C7TPI3_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A2S1MQV1_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A0C7T8J1_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A2S1MP06_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A2S1MXY9_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A0S2YQW9_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A0C7TJ32_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A385J8K7_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A2S1MV59_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A2S1MU91_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A2S1MM94_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A0U3U737_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A0C7TLW1_BALF1-0      --ctgt--------acgcggacctggcctg-------------c-aggac
A0A1P7TZL6_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
K9UT94_BALF1-01         --ctgt--------acgcggagctggcctg-------------c-aggac
P0CK58_BALF1-01         --ctgt--------acgcggagctggcctg-------------c-aggac
P0CK59_BALF1-01         --ctgt--------acgcggagctggcctg-------------c-aggac
A0A0C7TUX3_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
A0A2S1MTH2_BALF1-0      --ctgt--------acgcggagctggcctg-------------c-aggac
Q91HI3_BALF1-01         --ctgt--------acgcggagctggcctg-------------c-aagac
Q99F65_BALF1-01         --ctgt--------acgcggagctggcctg-------------c-aagac
H3ALX7_vNR13-01         --gtgg--------ctgagcagctggaggc-------------cgaaggc
Q9DH00_vNR13-01         --gtgg--------tgtctgaattgaactc-------------cggaagc
Q9DH00_vNR13-02         --gtgg--------tgtctgaattgaactc-------------cggaagc
A0A8C7EHJ2_vNR13-0      --gtgg--------cggcgcagctggaggc-------------cgagggc
A0A8C2U8D6_vNR13-0      --gtgg--------cggcgcagctggaggc-------------cgacggc
Q90343_vNR13-01         --gtgg--------cggcgcagctggagac-------------cgacggc
A0A674GY73_vNR13-0      --gtgg--------cggcgcagctggaggc-------------ggacggc
A0A8C3KMB5_vNR13-0      --gtgg--------cggcgcagctggaggc-------------cgacggc
A0A8D0KT43_vNR13-0      --gtgg--------cggcgcagctggaggc-------------cgacggc
A0A663ECE3_vNR13-0      --gtgg--------cggcgcagctggaggc-------------cgagggc
A0A8C4V604_vNR13-0      --gtgg--------cggcgcagctggaggc-------------cgacggc
A0A8B9GHZ4_vNR13-0      --gtgg--------cggtgcagctggaggc-------------tgacggc
A0A672TYX3_vNR13-0      --gtgg--------cggtgcagctggaggc-------------tgacggc
A0A8C5RRS8_vNR13-0      --gtgg--------ccacgcagatggaagc-------------cgaaggc
A0A8C6YHI4_vNR13-0      --gtgg--------ccacgcagatggaagc-------------cgaaggc
A0A8D0KNJ6_vNR13-0      --gtgg--------cggcgcagatggaagc-------------cgaaggc
A0A670KGT8_vNR13-0      --gtgg--------cggcgcagatggaagc-------------cgagggc
A0A8D2LWG1_vNR13-0      --gtgg--------cggcgcagatggaggc-------------ggagggc
A0A8D0L3Y5_vNR13-0      --gtgg--------cggccgagctggaggc-------------ggagggc
A0A8C8VNX1_vNR13-0      --gtgg--------ctgagcagctggaggc-------------ggagggc
A0A8C3SNB5_vNR13-0      --gtgg--------cggagcagctggaggc-------------ggagggc
A0A8C4VQB8_vNR13-0      --gtgg--------cggagcagctggaggc-------------ggagggc
A0A8C3IX63_vNR13-0      --gtgg--------cggagcagctggaggc-------------ggagggc
A0A674KEW6_vNR13-0      --gtgg--------cggagcagctggaggc-------------ggagggc
A1BM64_A9-01            --acct--------tcgaggtgatagtgga----------------tggg
Q2VSG7_A9-01            --acct--------tcgaggtgatagtgga----------------tggg
A0A1L2JVL1_A9-01        --cagt--------ttgaagtcatcagcaa-----------ctctgtaga
O36423_A9-01            --cagt--------ttgaagtcatcagcaa-----------ctctgtaga
Q1XBS8_VBCL2-01         ggacat--------ctttagcaattttttaacaaatattaattctgtgga
Q1XBS6_VBCL2-01         ggacat--------ctttagcaattttttaacaaatattaattctgtgga
Q1XBS7_VBCL2-01         ggacat--------ctttagcaattttttaacaaatattaattctgtgga
Q99D15_VBCL2-01         ggacat--------ctttagcaattttttaacaaatattaattctgtgga
Q9WH78_VBCL2-01         ggacat--------ctttagcaattttttaacaaatattaattctgtgga
P89884_M11-01           --ttgt--------ttgtagatgtcatcaa-------------cagtgga
B1PZP0_M11-01           --ttgt--------ttgtagatgtcatcaa-------------cagtgga
A0A6M4EIA3_M11-01       --ttgt--------ttgtagatgtcatcaa-------------cagtgga
D0U1R1_M11-01           --ttgt--------ttggagatgccatcaa-------------taggggg
Q9Q5K8_BHRF1-01         --gtgt--------ttgcggaaatttttca-------------caatgaa
Q9WGB5_BHRF1-01         --gtgt--------ttgcggaaatttttca-------------caatgaa
A0A0S0DHY9_BHRF1-0      --gtgt--------ttcaagaaatcttcca-------------ccgtgga
Q8UZJ4_BHRF1-01         --gtgt--------ttcaagaaatcttcca-------------ccgtgga
Q9IHR2_BHRF1-01         --gtat--------ttgaagatatatttca-------------ccgtgga
A0A0S2YQS0_BHRF1-0      --atat--------ttttagagatatttca-------------ccgtgga
A0A2H4Z4F2_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2S1N164_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2S1MYK7_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A410IGR6_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A4D6QZG6_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2H4Z4C5_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2S1MW70_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A3R5TSC7_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A451G5Y6_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A3R5U6U7_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2S1MWX4_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2S1MX38_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A451G617_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A4D6QS84_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A4D6R7N0_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2H4Z4M5_BHRF1-0      --gtat--------tttttgagatatttca-------------ccgtgga
A0A2H4Z4H8_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2H4Z4I4_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7TQI4_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A3R5UEL7_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2H4Z4I0_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A3R5X5H4_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0B6VHG4_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2H4Z4D6_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7U1E2_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2S1N3G0_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
V5KUE2_BHRF1-02         --gtat--------ttttagagatatttca-------------ccgtgga
A0A4D6TWZ3_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A385J9R2_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7T924_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7T6R4_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A385J8Q6_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A4D6TV66_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7T306_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A385J7D0_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A4D6R3D4_BHRF1-0      --gtat--------ttgtagagatatttca-------------ccgtgga
A0A0X9C4Q9_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0X8YIW3_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A4D6QKL8_BHRF1-0      --gtat--------ttgtagagatatttca-------------ccgtgga
A0A3R5TRD4_BHRF1-0      --gtat--------ttgtagagatatttca-------------ccgtgga
A0A385J922_BHRF1-0      --gtat--------ttgtagagatatttca-------------ccgtgga
A0A2H4Z4F8_BHRF1-0      --gtat--------ttgtagagatatttca-------------ccgtgga
A0A2H4Z4E3_BHRF1-0      --gtat--------ttgtagagatatttca-------------ccgtgga
A0A2H4Z4D9_BHRF1-0      --gtat--------ttgtagagatatttca-------------ccgtgga
K9UTF7_BHRF1-01         --gtat--------ttgtagagatatttca-------------ccgtgga
A0A0C7TWM2_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2D1LYW3_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7TK05_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
P03182_BHRF1-01         --gtat--------ttttagagatatttca-------------ccgtgga
A0A410I865_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A385JAL1_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2S1N3U3_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2S1MNB9_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A2S1MMY2_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0S2YRE8_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7TX82_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7TTN2_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7TNT4_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
A0A0C7SXB3_BHRF1-0      --gtat--------ttttagagatatttca-------------ccgtgga
K9UTN7_BHRF1-01         --gtat--------ttttagagatatttca-------------ccgtgga
V5KU29_BHRF1-02         --gtat--------ttttagagatatttca-------------ccgtgga
                                                                          

P90504_ORF16-01         aacat----gaactgggggcgag----ccctggctatactga-------c
F5HGJ3_ORF16-01         aacat----gaactgggggcgag----ccctggctatactga-------c
Q76RI8_ORF16-01         aacat----gaactgggggcgag----ccctggctatactga-------c
Q99F66_BALF1-01         ggcgg----acattggaggcaag----cacgcccacgtgcagc------t
A0A4D6QN24_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A385JB67_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A4D6R4T3_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A385J7X7_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A0C7TV67_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A2S1N1Z2_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A2S1N2H2_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A4D6TWI9_BALF1-0      ngccg----acatcgggggcaan----gacacgcacgtacggc------t
A0A4D6R8R0_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A3R5WV36_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A4D6RFR1_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A4D6RC31_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A4D6RBY3_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A3R5WYW3_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A3R5WNA2_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A075FFB0_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A075FCZ0_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A410I1F1_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
U5YUM6_BALF1-01         agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A4D6RE52_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A7G1IXW1_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A0A8IKW4_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A4D6R8J3_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A2S1MZQ8_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A385JAB4_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A4D6QXN1_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacagc------t
A0A4D6QMD2_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A410J0D8_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A410I9N0_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A3R5ZJV6_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A3R5WKR1_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A0U3UKR9_BALF1-0      agccg----acatcaggggcaaa----gacacgcacgtacggc------t
A0A2D1LYV4_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
Q91HV2_BALF1-01         agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A0C7TPI3_BALF1-0      agccg----acgtcgggggcaaa----gacacgcacgtacggc------t
A0A2S1MQV1_BALF1-0      agccg----acgtcgggggcaaa----gacacgcacgtacggc------t
A0A0C7T8J1_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacgga------t
A0A2S1MP06_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacgga------t
A0A2S1MXY9_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A0S2YQW9_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A0C7TJ32_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A385J8K7_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A2S1MV59_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A2S1MU91_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A2S1MM94_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A0U3U737_BALF1-0      agccg----acatcggggacaaa----gacacgcacgtacggc------t
A0A0C7TLW1_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A1P7TZL6_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
K9UT94_BALF1-01         agccg----acatcgggggcaaa----gacacgcacgtacggc------t
P0CK58_BALF1-01         agccg----acatcgggggcaaa----gacacgcacgtacggc------t
P0CK59_BALF1-01         agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A0C7TUX3_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
A0A2S1MTH2_BALF1-0      agccg----acatcgggggcaaa----gacacgcacgtacggc------t
Q91HI3_BALF1-01         ggcgg----atatcgggggcaag----cacgcgcacgtgcagc------t
Q99F65_BALF1-01         ggcgg----acattgggggcagg----cacgctcacgtccagc------t
H3ALX7_vNR13-01         ggctt----gaactgggggaggg----tggtgagtttatttg-------c
Q9DH00_vNR13-01         ggctt----caactggggtcgat----gcctggcgaccatag-------t
Q9DH00_vNR13-02         ggctt----caactggggtcgat----gcctggcgaccatag-------t
A0A8C7EHJ2_vNR13-0      ggcct----caactggggccggc----tgctggcgctcgtgg-------t
A0A8C2U8D6_vNR13-0      ggcct----gaactggggccggc----tgctggcgctcgtgg-------t
Q90343_vNR13-01         ggcct----gaactggggccggc----tgctggcgctcgtgg-------t
A0A674GY73_vNR13-0      ggcct----caactggggccggc----tgctggcgctcgtgg-------t
A0A8C3KMB5_vNR13-0      ggcct----caactggggccggc----tgctggccctggtgg-------t
A0A8D0KT43_vNR13-0      ggcct----caactggggccggc----tgctggcgctggtgg-------t
A0A663ECE3_vNR13-0      ggcct----caactggggccggc----tgctggcgctggtgg-------t
A0A8C4V604_vNR13-0      ggcct----cagctggggccggc----tgctggcgctggtgg-------t
A0A8B9GHZ4_vNR13-0      ggcct----caactggggccgga----tcctggcgctcgtgg-------t
A0A672TYX3_vNR13-0      ggcct----caattggggccggc----tgctggcgctcgtgg-------t
A0A8C5RRS8_vNR13-0      ggcct----gaactggggccggg----tggtggcgctggtcg-------t
A0A8C6YHI4_vNR13-0      ggcct----gaactggggccggg----tggtggcgctggtcg-------t
A0A8D0KNJ6_vNR13-0      ggcct----caactggggccggg----tggtggcgctggtcg-------t
A0A670KGT8_vNR13-0      ggcct----caactggggccggg----tggtggcgctggtcg-------t
A0A8D2LWG1_vNR13-0      ggcct----caactggggccggg----tggtggcgctggtcg-------t
A0A8D0L3Y5_vNR13-0      ggcct----caactggggccggg----tgctggcgctggtgg-------t
A0A8C8VNX1_vNR13-0      ggcct----caactggggccggg----tgctggcgctggtgg-------t
A0A8C3SNB5_vNR13-0      ggcct----caactggggccggg----tgctggcgctggtgg-------t
A0A8C4VQB8_vNR13-0      ggcct----gaactggggccggg----tgctggcgctggtgg-------t
A0A8C3IX63_vNR13-0      ggcct----gaactggggccgag----tgctggcgctggtgg-------t
A0A674KEW6_vNR13-0      ggcct----gaactggggccgag----tgctggcgctggtgg-------t
A1BM64_A9-01            g--tcggacacccctctcccgagt---cactggaacggatagccaagtcg
Q2VSG7_A9-01            g--tcggacacccctctcccgagt---cactggaacggatagccaagtcg
A0A1L2JVL1_A9-01        agccccc--gagcctgagt--------cactggagaggattgcaaaaaca
O36423_A9-01            agccccc--gagcctgagt--------cactggagaggattgcaaaaaca
Q1XBS8_VBCL2-01         ggatttggagaccctgggccacgccatcactacgttaaatgactacc--c
Q1XBS6_VBCL2-01         ggatttggagaccctgggccacgccatcactacgttaaatgactatc--c
Q1XBS7_VBCL2-01         ggatttggagaccctgggccacgccatcactacgttaaatgactatc--c
Q99D15_VBCL2-01         agatttggaaaccctgggccacgccatcactacgttaaatgactatc--c
Q9WH78_VBCL2-01         agatttggaaaccctgggccatgccatcactacgttaaatgactatc--c
P89884_M11-01           a---------------------g----aattg--ttggattttttga--t
B1PZP0_M11-01           a---------------------g----aattg--ttggattttttga--t
A0A6M4EIA3_M11-01       a---------------------g----aattg--ttggattttttga--t
D0U1R1_M11-01           a---------------------g----aattg--ttggattttttga--t
Q9Q5K8_BHRF1-01         gaccc----aacacttgggcgag----gattggcttggctggcctgg--t
Q9WGB5_BHRF1-01         gaccc----aacacttgggcgag----gattggcttggctggcctgg--t
A0A0S0DHY9_BHRF1-0      aatcc----cactctggggcgag----cgttggcctggctggcttgg--t
Q8UZJ4_BHRF1-01         aatcc----cactctgggacgag----cgttggcctggctggcctgg--t
Q9IHR2_BHRF1-01         gatcc----atcccttgggcgag----cgttggcctggctggcctgg--t
A0A0S2YQS0_BHRF1-0      gaccc----aagccgtgggcgcg----cgttggcctggctggcctgg--t
A0A2H4Z4F2_BHRF1-0      gaccc----cagccttgggtgcg----cgttgacctggatggcctgg--g
A0A2S1N164_BHRF1-0      gaccc----aagccttgggcgtg----cgttggcctggatggcctgg--t
A0A2S1MYK7_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A410IGR6_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A4D6QZG6_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2H4Z4C5_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2S1MW70_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A3R5TSC7_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A451G5Y6_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A3R5U6U7_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2S1MWX4_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2S1MX38_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A451G617_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A4D6QS84_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A4D6R7N0_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2H4Z4M5_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2H4Z4H8_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2H4Z4I4_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7TQI4_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A3R5UEL7_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2H4Z4I0_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A3R5X5H4_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0B6VHG4_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2H4Z4D6_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7U1E2_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2S1N3G0_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
V5KUE2_BHRF1-02         gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A4D6TWZ3_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatgncctgg--t
A0A385J9R2_BHRF1-0      grccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7T924_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7T6R4_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A385J8Q6_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A4D6TV66_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7T306_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A385J7D0_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A4D6R3D4_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0X9C4Q9_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0X8YIW3_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A4D6QKL8_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A3R5TRD4_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A385J922_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2H4Z4F8_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2H4Z4E3_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2H4Z4D9_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
K9UTF7_BHRF1-01         gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7TWM2_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2D1LYW3_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7TK05_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
P03182_BHRF1-01         gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A410I865_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A385JAL1_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2S1N3U3_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2S1MNB9_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A2S1MMY2_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0S2YRE8_BHRF1-0      gaccc----aagacttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7TX82_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7TTN2_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
A0A0C7TNT4_BHRF1-0      gaccc----aagccttgggcgca----cgttggcctggatggcctgg--t
A0A0C7SXB3_BHRF1-0      gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
K9UTN7_BHRF1-01         gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
V5KU29_BHRF1-02         gaccc----aagccttgggcgcg----cgttggcctggatggcctgg--t
                                                                          

P90504_ORF16-01         ctttggca------gttttgtggcccagaagttatccaa-----------
F5HGJ3_ORF16-01         ctttggca------gttttgtggcccagaagttatccaa-----------
Q76RI8_ORF16-01         ctttggca------gttttgtggcccagaagttatccaa-----------
Q99F66_BALF1-01         catcatca------gcatcctgcgcgccgtgtacgacga------ccact
A0A4D6QN24_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A385JB67_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A4D6R4T3_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A385J7X7_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A0C7TV67_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1N1Z2_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1N2H2_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A4D6TWI9_BALF1-0      catcatca------gcgtcctgcgcgcattgtacaacga------ccact
A0A4D6R8R0_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A3R5WV36_BALF1-0      catcatca------gcatcctgcgcgcagtgtacaacga------ccact
A0A4D6RFR1_BALF1-0      catcatca------gcgtcctgtgcgcagtgtacaacga------ccact
A0A4D6RC31_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A4D6RBY3_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A3R5WYW3_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A3R5WNA2_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A075FFB0_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A075FCZ0_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A410I1F1_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
U5YUM6_BALF1-01         catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A4D6RE52_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A7G1IXW1_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A0A8IKW4_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A4D6R8J3_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1MZQ8_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A385JAB4_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A4D6QXN1_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A4D6QMD2_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A410J0D8_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A410I9N0_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A3R5ZJV6_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A3R5WKR1_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A0U3UKR9_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2D1LYV4_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
Q91HV2_BALF1-01         catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A0C7TPI3_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1MQV1_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A0C7T8J1_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1MP06_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1MXY9_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A0S2YQW9_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A0C7TJ32_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A385J8K7_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1MV59_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1MU91_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1MM94_BALF1-0      catcatca------gcgtcctgcgcgcattgtacaacga------ccact
A0A0U3U737_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A0C7TLW1_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A1P7TZL6_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
K9UT94_BALF1-01         catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
P0CK58_BALF1-01         catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
P0CK59_BALF1-01         catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A0C7TUX3_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
A0A2S1MTH2_BALF1-0      catcatca------gcgtcctgcgcgcagtgtacaacga------ccact
Q91HI3_BALF1-01         catcatca------gcgtcctgcgcgccgtgtacgacga------ccact
Q99F65_BALF1-01         catcacca------gcgtcctgcgcgctgtgtacgacga------ccact
H3ALX7_vNR13-01         cttcgcgg------gctgcttggctaaag---gggtccagcgggcccaga
Q9DH00_vNR13-01         cctcggcg------gctcgctggcaacggcgctgtacgaaaacggctgtg
Q9DH00_vNR13-02         cctcggcg------gctcgctggcaacggcgctgtacgaaaacggctgtg
A0A8C7EHJ2_vNR13-0      gttcgcgg------gcgcgctggccgccgccatggcggagcgcggctgcg
A0A8C2U8D6_vNR13-0      gttcgccg------gcacgttggcggcagcgctgaccgagagcggctgcg
Q90343_vNR13-01         gttcgccg------gcacgttggcggcagcgctggccgagagcgcctgcg
A0A674GY73_vNR13-0      gttcgccg------gcacgctggcggccgcgctggccgagcggggctgca
A0A8C3KMB5_vNR13-0      cttcgccg------gcacgctggccgccgcgctggccgagcggggctgcg
A0A8D0KT43_vNR13-0      gttcgccg------gcacgctggccgccgcgctggccgagcggggctgcg
A0A663ECE3_vNR13-0      cttcgccg------gcacgctggccgccgcgctgaccgagcggggctgcg
A0A8C4V604_vNR13-0      cttcgccg------gcacgctggccgccgcgctggccgagcggggctgcg
A0A8B9GHZ4_vNR13-0      gttcgccg------gcacgctggcggccgcgctggacgagcggggctgca
A0A672TYX3_vNR13-0      gttcgccg------gcacgctggcggccgcgctggacgagcggggctgcg
A0A8C5RRS8_vNR13-0      gttcgccg------gcaacctggcggcggcgctggccgagcggggcggcc
A0A8C6YHI4_vNR13-0      gttcgccg------gcaacctggcggcggcgctggccgagcgaggcgctc
A0A8D0KNJ6_vNR13-0      gttcgccg------gcaacctggcggccgcgctggccgagcgcggggctc
A0A670KGT8_vNR13-0      gttcgccg------gcaacttggcggcggcgctggccgagcgcggcgctc
A0A8D2LWG1_vNR13-0      gttcgccg------ggaacctggcggcggcgctggccgagcgcggagctc
A0A8D0L3Y5_vNR13-0      gttcgcgg------gcagcctagccgaggcgctggtagagcgaggcgccc
A0A8C8VNX1_vNR13-0      gttcgcgg------gcagcctggcggcggcgctggccgagcacgggagcc
A0A8C3SNB5_vNR13-0      gttcgcgg------ggagcctggcggcggcgctggccgagcaaggcagcc
A0A8C4VQB8_vNR13-0      gttcgcgg------ggagcctggcggcggcgctggccgagcagggcagcc
A0A8C3IX63_vNR13-0      gttcgcgg------ggagcctggcggcggcgctggccgagcagggcagcc
A0A674KEW6_vNR13-0      gttcgcgg------ggagcctggcggcggcgctggccgagcagggcagcc
A1BM64_A9-01            cttttcaccccacggcccaactggggtcgggttgt--g------------
Q2VSG7_A9-01            ctattcaccccacggcccaactggggtcgggttgt--g------------
A0A1L2JVL1_A9-01        ctcttcac------accccgtccacactggg-gga--ggctggtggcatt
O36423_A9-01            ctcttcac------accccgtccacactggg-gga--ggctggtggcatt
Q1XBS8_VBCL2-01         ctccccaa------acatgggcagagttgtatgtg--gcatagcattctc
Q1XBS6_VBCL2-01         ctccccaa------acatgggcagagttgtatgtg--gcatagcattctc
Q1XBS7_VBCL2-01         ctccccaa------acatgggcagagttgtatgtg--gcatagcattctc
Q99D15_VBCL2-01         ctccccaa------acatgggcagagttgtatgtg--gcatagcattttc
Q9WH78_VBCL2-01         ctccccaa------acatgggcagagttgtatgtg--gcatagcattttc
P89884_M11-01           gttggcag------atatg--------tgtgtgag--gagg---------
B1PZP0_M11-01           gttggcag------atatg--------tgtgtgag--gagg---------
A0A6M4EIA3_M11-01       gttggcag------atatg--------tgtgtgag--gagg---------
D0U1R1_M11-01           gttggaag------atatg--------tgtgtgaa--gagc---------
Q9Q5K8_BHRF1-01         gcatgcat------gcctgcagaactttatgtggt--gacactaactgtc
Q9WGB5_BHRF1-01         gcatgcat------gcctgcagaactttatgtggt--gacactaactgtc
A0A0S0DHY9_BHRF1-0      gcatgcat------gcctgcaggacgttgtgttgt--aacaggaatactc
Q8UZJ4_BHRF1-01         gcatgcat------gcctgcaggacgttgtgttgt--aacaggaatactc
Q9IHR2_BHRF1-01         gtatgcat------gcctgcaggacattgtgcagg--aaccagaacactc
A0A0S2YQS0_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccaggacactc
A0A2H4Z4F2_BHRF1-0      gcatgcat------gcctgttggaccttgtgttgt--aaccagtctactc
A0A2S1N164_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A2S1MYK7_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A410IGR6_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A4D6QZG6_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A2H4Z4C5_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A2S1MW70_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A3R5TSC7_BHRF1-0      gcatgcat------gcctgtaggacattgtgttct--aaccagtctactc
A0A451G5Y6_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A3R5U6U7_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A2S1MWX4_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A2S1MX38_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A451G617_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A4D6QS84_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A4D6R7N0_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A2H4Z4M5_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A2H4Z4H8_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A2H4Z4I4_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A0C7TQI4_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtatactc
A0A3R5UEL7_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtatactc
A0A2H4Z4I0_BHRF1-0      gcatgcat------gcctgtaggacattgtgttgt--aaccagtctactc
A0A3R5X5H4_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0B6VHG4_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtatactc
A0A2H4Z4D6_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtatactc
A0A0C7U1E2_BHRF1-0      gcatgcat------gcctgcaggacattgtgttat--aaccagtctactc
A0A2S1N3G0_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
V5KUE2_BHRF1-02         gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A4D6TWZ3_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A385J9R2_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0C7T924_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0C7T6R4_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A385J8Q6_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A4D6TV66_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0C7T306_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A385J7D0_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A4D6R3D4_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0X9C4Q9_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0X8YIW3_BHRF1-0      gcatgcat------gcctgcagggcattgtgttgt--aaccagtctactc
A0A4D6QKL8_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A3R5TRD4_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtgtactc
A0A385J922_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A2H4Z4F8_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A2H4Z4E3_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A2H4Z4D9_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
K9UTF7_BHRF1-01         gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0C7TWM2_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A2D1LYW3_BHRF1-0      gcatgcat------gcctgcaggagattgtgttgt--aaccagtctactc
A0A0C7TK05_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aacccgtctactc
P03182_BHRF1-01         gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A410I865_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A385JAL1_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A2S1N3U3_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A2S1MNB9_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A2S1MMY2_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0S2YRE8_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0C7TX82_BHRF1-0      gcatgtat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0C7TTN2_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0C7TNT4_BHRF1-0      gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
A0A0C7SXB3_BHRF1-0      gcatgcat------gcctgcaggacattgtgtttt--aaccagtctactc
K9UTN7_BHRF1-01         gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
V5KU29_BHRF1-02         gcatgcat------gcctgcaggacattgtgttgt--aaccagtctactc
                                                                          

P90504_ORF16-01         ----cga---------acctcacctg---------cgagactttgctttg
F5HGJ3_ORF16-01         ----cga---------acctcacctg---------cgagactttgctttg
Q76RI8_ORF16-01         ----cga---------acctcacctg---------cgagactttgctttg
Q99F66_BALF1-01         acgacta----------------------------ctggtcgcggctcag
A0A4D6QN24_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A385JB67_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A4D6R4T3_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A385J7X7_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A0C7TV67_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1N1Z2_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1N2H2_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A4D6TWI9_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A4D6R8R0_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A3R5WV36_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A4D6RFR1_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A4D6RC31_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A4D6RBY3_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A3R5WYW3_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A3R5WNA2_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A075FFB0_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A075FCZ0_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A410I1F1_BALF1-0      acgacta----------------------------ctggtcgcggctcag
U5YUM6_BALF1-01         acgacta----------------------------ctggtcgcggctcag
A0A4D6RE52_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A7G1IXW1_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A0A8IKW4_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A4D6R8J3_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1MZQ8_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A385JAB4_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A4D6QXN1_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A4D6QMD2_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A410J0D8_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A410I9N0_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A3R5ZJV6_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A3R5WKR1_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A0U3UKR9_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2D1LYV4_BALF1-0      acgacta----------------------------ctggtcgcggctcag
Q91HV2_BALF1-01         acgacta----------------------------ctggtcgcggctcag
A0A0C7TPI3_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1MQV1_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A0C7T8J1_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1MP06_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1MXY9_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A0S2YQW9_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A0C7TJ32_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A385J8K7_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1MV59_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1MU91_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1MM94_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A0U3U737_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A0C7TLW1_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A1P7TZL6_BALF1-0      acgacta----------------------------ctggtcgcggctcag
K9UT94_BALF1-01         acgacta----------------------------ctggtcgcggctcag
P0CK58_BALF1-01         acgacta----------------------------ctggtcgcggctcag
P0CK59_BALF1-01         acgacta----------------------------ctggtcgcggctcag
A0A0C7TUX3_BALF1-0      acgacta----------------------------ctggtcgcggctcag
A0A2S1MTH2_BALF1-0      acgacta----------------------------ctggtcgcggctcag
Q91HI3_BALF1-01         acgacta----------------------------ctggtcgcgtctcag
Q99F65_BALF1-01         gcgacta----------------------------ctggtcgcgtctcag
H3ALX7_vNR13-01         atgaggagtgtgcgatgggagcctgctgtgggaagttggctgaagctctg
Q9DH00_vNR13-01         aggaagg---------gccaagccgc---------ttggccgcagcgctg
Q9DH00_vNR13-02         aggaagg---------gccaagccgc---------ttggccgcagcgctg
A0A8C7EHJ2_vNR13-0      ccgacgg---------gccgcgccgc---------ctggccgccgcgctc
A0A8C2U8D6_vNR13-0      aggaagg---------gccgagccgc---------ctggccgccgcgctg
Q90343_vNR13-01         aggaagg---------gccgagccgc---------ctggccgccgcgctg
A0A674GY73_vNR13-0      gcgacgg---------gccgcgctgc---------ctggccgcgcacctg
A0A8C3KMB5_vNR13-0      gcgaggg---------gccgcgctgc---------ctggccgccgcgctg
A0A8D0KT43_vNR13-0      gcgacgg---------gccgcgctgc---------ctggccgccgcgctg
A0A663ECE3_vNR13-0      gcgacgg---------gccgcgctgc---------ctggccgccgcgctg
A0A8C4V604_vNR13-0      gcgacgg---------gccgcgctgc---------ctggccgccgcgctg
A0A8B9GHZ4_vNR13-0      ccgacgg---------cccgcgctgc---------ctggccgccgcgctg
A0A672TYX3_vNR13-0      ccgacgg---------gccgcgctgc---------ctggccgccgcgctg
A0A8C5RRS8_vNR13-0      cggatca---------cagcggcgcg---------ctggtggaggcgctg
A0A8C6YHI4_vNR13-0      cggatca---------cagcggcgcg---------ctggtcgaggcgctg
A0A8D0KNJ6_vNR13-0      gcggcgacgaggagacgccgggcgcg---------ctggccgaggcgctc
A0A670KGT8_vNR13-0      gcgacca---------gacggccgct---------ctggcggaggcgctg
A0A8D2LWG1_vNR13-0      gcgacga---------gacgggcgcg---------ctggtggaggcgctg
A0A8D0L3Y5_vNR13-0      gggaaga---------gaccggccgc---------ttggccgaggtgctg
A0A8C8VNX1_vNR13-0      gggagga---------ggcgggccgc---------ctggccgaggtgctg
A0A8C3SNB5_vNR13-0      gggagga---------ggcgggccgc---------ttggccgaggtgctg
A0A8C4VQB8_vNR13-0      gggagga---------ggcgggccgc---------ttggccgaggtgctg
A0A8C3IX63_vNR13-0      gggagga---------ggcgggccgc---------ttggccgaggtgctg
A0A674KEW6_vNR13-0      gggagga---------ggcgggccgc---------ttggccgaggtgctg
A1BM64_A9-01            ------a------------------------------tgttttttgccta
Q2VSG7_A9-01            ------a------------------------------tgttttttgccta
A0A1L2JVL1_A9-01        tctagca------------------------------tac------ttgg
O36423_A9-01            tctagca------------------------------tac------ttgg
Q1XBS8_VBCL2-01         tgt-cta------------------------------tgttgt---ccag
Q1XBS6_VBCL2-01         tgt-cta------------------------------tgttgt---ccag
Q1XBS7_VBCL2-01         tgt-cta------------------------------tgttgt---ccag
Q99D15_VBCL2-01         tgt-cta------------------------------tgttgt---ccag
Q9WH78_VBCL2-01         tgt-cta------------------------------tgttgt---ccag
P89884_M11-01           --tacta------------------------------tgt------cccg
B1PZP0_M11-01           --tacta------------------------------tgt------cccg
A0A6M4EIA3_M11-01       --tacta------------------------------tgt------cccg
D0U1R1_M11-01           --tactg------------------------------tgt------ccag
Q9Q5K8_BHRF1-01         cctacta------------------------------tgttgtggacctg
Q9WGB5_BHRF1-01         cctacta------------------------------tgttgtggacctg
A0A0S0DHY9_BHRF1-0      cctacta------------------------------tgttgtggacctg
Q8UZJ4_BHRF1-01         cctacta------------------------------tgttgtggacctg
Q9IHR2_BHRF1-01         cttacta------------------------------tgttgtggacctg
A0A0S2YQS0_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4F2_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2S1N164_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2S1MYK7_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A410IGR6_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A4D6QZG6_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4C5_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2S1MW70_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A3R5TSC7_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A451G5Y6_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A3R5U6U7_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2S1MWX4_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2S1MX38_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A451G617_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A4D6QS84_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A4D6R7N0_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4M5_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4H8_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4I4_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7TQI4_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A3R5UEL7_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4I0_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A3R5X5H4_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0B6VHG4_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4D6_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7U1E2_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2S1N3G0_BHRF1-0      cttacta------------------------------tgttgtggacctg
V5KUE2_BHRF1-02         cttacta------------------------------tgttgtggacctg
A0A4D6TWZ3_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A385J9R2_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7T924_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7T6R4_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A385J8Q6_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A4D6TV66_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7T306_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A385J7D0_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A4D6R3D4_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0X9C4Q9_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0X8YIW3_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A4D6QKL8_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A3R5TRD4_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A385J922_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4F8_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4E3_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2H4Z4D9_BHRF1-0      cttacta------------------------------tgttgtggacctg
K9UTF7_BHRF1-01         cttacta------------------------------tgttgtggacctg
A0A0C7TWM2_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2D1LYW3_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7TK05_BHRF1-0      cttacta------------------------------tgttgtggacctg
P03182_BHRF1-01         cttacta------------------------------tgttgtggacctg
A0A410I865_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A385JAL1_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2S1N3U3_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2S1MNB9_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A2S1MMY2_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0S2YRE8_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7TX82_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7TTN2_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7TNT4_BHRF1-0      cttacta------------------------------tgttgtggacctg
A0A0C7SXB3_BHRF1-0      cttacta------------------------------tgttgtggacctg
K9UTN7_BHRF1-01         cttacta------------------------------tgttgtggacctg
V5KU29_BHRF1-02         cttacta------------------------------tgttgtggacctg
                                                                          

P90504_ORF16-01         gccg------ttttacctgtatatgcgtatgaagcaatcggaccccagtg
F5HGJ3_ORF16-01         gccg------ttttacctgtatatgcgtatgaagcaatcggaccccagtg
Q76RI8_ORF16-01         gccg------ttttacctgtatatgcgtatgaagcaatcggaccccagtg
Q99F66_BALF1-01         ggtggtgctgtgctacgcggttgtgtttgcggtgcg--------aaacta
A0A4D6QN24_BALF1-0      ggtggtgctgtgctacacagttgtgtttgcggtgcg--------aaacta
A0A385JB67_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6R4T3_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A385J7X7_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0C7TV67_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1N1Z2_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1N2H2_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6TWI9_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6R8R0_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A3R5WV36_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6RFR1_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6RC31_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6RBY3_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A3R5WYW3_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A3R5WNA2_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A075FFB0_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A075FCZ0_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A410I1F1_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
U5YUM6_BALF1-01         ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6RE52_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A7G1IXW1_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0A8IKW4_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6R8J3_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1MZQ8_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A385JAB4_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6QXN1_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A4D6QMD2_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A410J0D8_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A410I9N0_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A3R5ZJV6_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A3R5WKR1_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0U3UKR9_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2D1LYV4_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
Q91HV2_BALF1-01         ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0C7TPI3_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1MQV1_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0C7T8J1_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1MP06_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1MXY9_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0S2YQW9_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0C7TJ32_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A385J8K7_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1MV59_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1MU91_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1MM94_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0U3U737_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0C7TLW1_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A1P7TZL6_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
K9UT94_BALF1-01         ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
P0CK58_BALF1-01         ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
P0CK59_BALF1-01         ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A0C7TUX3_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
A0A2S1MTH2_BALF1-0      ggtggtgctgtgctacacagtggtgtttgcggtgcg--------aaacta
Q91HI3_BALF1-01         ggtcgtgttgtgctacacggtggtgtttgcggtgcg--------aaacta
Q99F65_BALF1-01         ggtggtgctgtgctacacggtggtgtttgcggtgcg--------aaacta
H3ALX7_vNR13-01         gtta-------actacctggccaag---gaaagagg--------ggactg
Q9DH00_vNR13-01         gccg-------cgtacctggccgaa---gagcaggg--------cgagtg
Q9DH00_vNR13-02         gccg-------cgtacctggccgaa---gagcaggg--------cgagtg
A0A8C7EHJ2_vNR13-0      accg-------actacctggccgag---gagaaggg--------cgcctg
A0A8C2U8D6_vNR13-0      accg-------cgtacctggccgag---gagcaggg--------agagtg
Q90343_vNR13-01         accg-------cgtacctggccgag---gagcaggg--------agagtg
A0A674GY73_vNR13-0      gccg-------cgtacctggccgag---gagcgcgg--------cgagtg
A0A8C3KMB5_vNR13-0      gccg-------cctacctggccgag---gagcgggg--------cgagtg
A0A8D0KT43_vNR13-0      gccg-------cctacctggccgag---gagcgggg--------cgagtg
A0A663ECE3_vNR13-0      gccg-------cctacctggccgag---gagcgggg--------cgagtg
A0A8C4V604_vNR13-0      gccg-------cctacctggccgag---gagcgggg--------cgagtg
A0A8B9GHZ4_vNR13-0      gctg-------catacctggccgag---gagcgcgg--------cgagtg
A0A672TYX3_vNR13-0      gccg-------cctacctggccgag---gagcgcgg--------cgagtg
A0A8C5RRS8_vNR13-0      gccg-------cctacctggccgag---gaacggcg--------ggactg
A0A8C6YHI4_vNR13-0      gccg-------cctacctggccgag---gaacggcg--------ggactg
A0A8D0KNJ6_vNR13-0      gccg-------cgtacctggccggc---gagaagcg--------ggagtg
A0A670KGT8_vNR13-0      gccg-------cctacttggccggg---gagaagcg--------agagtg
A0A8D2LWG1_vNR13-0      gccg-------cctacttggccggg---gagaagcg--------cgagtg
A0A8D0L3Y5_vNR13-0      agca-------cctacctagccggg---gagaagcg--------cgagtg
A0A8C8VNX1_vNR13-0      gccg-------cctacctggccgag---gagaagcg--------cgagtg
A0A8C3SNB5_vNR13-0      gccg-------cctacctggccgag---gagaagcg--------cgagtg
A0A8C4VQB8_vNR13-0      gcct-------cctacctggccgag---gagaagcg--------cgagtg
A0A8C3IX63_vNR13-0      gcct-------cctacctggccgag---gagaagcg--------cgagtg
A0A674KEW6_vNR13-0      gcct-------cctacctggccgag---gagaagcg--------cgagtg
A1BM64_A9-01            tttg------------ttttacctg-----------------------ca
Q2VSG7_A9-01            tttg------------ttttacctg-----------------------ca
A0A1L2JVL1_A9-01        ctta------------tttgcagaa-----------------------ga
O36423_A9-01            ctta------------tttgcagaa-----------------------ga
Q1XBS8_VBCL2-01         actg------------tgtgtaagagaaaaccactattggtcaggtgctg
Q1XBS6_VBCL2-01         actg------------tgtgtaagagaaaaccactattggtcaggtgctg
Q1XBS7_VBCL2-01         actg------------tgtgtaagagaaaaccactattggtcaggtgctg
Q99D15_VBCL2-01         actg------------tctgtaagaggaaaccactattggtcaggtgctg
Q9WH78_VBCL2-01         actg------------tctgtaagagaaaaccactattggtcaggtgctg
P89884_M11-01           gcag------------ttggacgga-----------------------gg
B1PZP0_M11-01           gcag------------ttggacgga-----------------------gg
A0A6M4EIA3_M11-01       gcag------------ttggacgga-----------------------gg
D0U1R1_M11-01           gcag------------ttggacgga-----------------------gg
Q9Q5K8_BHRF1-01         gcag------------ttcgtggaa-----------------------tg
Q9WGB5_BHRF1-01         gcag------------ttcgtggaa-----------------------tg
A0A0S0DHY9_BHRF1-0      tcag------------ttcgtggga-----------------------tg
Q8UZJ4_BHRF1-01         tcgg------------ttcgtggga-----------------------tg
Q9IHR2_BHRF1-01         tcag------------ttcgtggga-----------------------tg
A0A0S2YQS0_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4F2_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2S1N164_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2S1MYK7_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A410IGR6_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A4D6QZG6_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4C5_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2S1MW70_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A3R5TSC7_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A451G5Y6_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A3R5U6U7_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2S1MWX4_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2S1MX38_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A451G617_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A4D6QS84_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A4D6R7N0_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4M5_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4H8_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4I4_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7TQI4_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A3R5UEL7_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4I0_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A3R5X5H4_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0B6VHG4_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4D6_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7U1E2_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2S1N3G0_BHRF1-0      tcag------------ttcgtggga-----------------------tg
V5KUE2_BHRF1-02         tcag------------ttcgtggga-----------------------tg
A0A4D6TWZ3_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A385J9R2_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7T924_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7T6R4_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A385J8Q6_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A4D6TV66_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7T306_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A385J7D0_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A4D6R3D4_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0X9C4Q9_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0X8YIW3_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A4D6QKL8_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A3R5TRD4_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A385J922_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4F8_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4E3_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2H4Z4D9_BHRF1-0      tcag------------ttcgtggga-----------------------tg
K9UTF7_BHRF1-01         tcag------------ttcgtggga-----------------------tg
A0A0C7TWM2_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2D1LYW3_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7TK05_BHRF1-0      tcag------------ttcgtggga-----------------------tg
P03182_BHRF1-01         tcag------------ttcgtggga-----------------------tg
A0A410I865_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A385JAL1_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2S1N3U3_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2S1MNB9_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A2S1MMY2_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0S2YRE8_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7TX82_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7TTN2_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7TNT4_BHRF1-0      tcag------------ttcgtggga-----------------------tg
A0A0C7SXB3_BHRF1-0      tcag------------ttcgtggga-----------------------tg
K9UTN7_BHRF1-01         tcag------------ttcgtggga-----------------------tg
V5KU29_BHRF1-02         tcag------------ttcgtggga-----------------------tg
                                                                          

P90504_ORF16-01         gtttcg------------cgctcgcg--gagg-------------ctgg-
F5HGJ3_ORF16-01         gtttcg------------cgctcgcg--gagg-------------ctgg-
Q76RI8_ORF16-01         gtttcg------------cgctcgcg--gagg-------------ctgg-
Q99F66_BALF1-01         cctgga------------tgaccacg--agagtgccgccttcgtgctgg-
A0A4D6QN24_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A385JB67_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6R4T3_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A385J7X7_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0C7TV67_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1N1Z2_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1N2H2_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6TWI9_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6R8R0_BALF1-0      cctggg------------tgaccaca--agagcgccgccttcgtgctgg-
A0A3R5WV36_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6RFR1_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6RC31_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6RBY3_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A3R5WYW3_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A3R5WNA2_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A075FFB0_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A075FCZ0_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A410I1F1_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
U5YUM6_BALF1-01         cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6RE52_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A7G1IXW1_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0A8IKW4_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6R8J3_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1MZQ8_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A385JAB4_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6QXN1_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A4D6QMD2_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A410J0D8_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A410I9N0_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A3R5ZJV6_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A3R5WKR1_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0U3UKR9_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2D1LYV4_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
Q91HV2_BALF1-01         cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0C7TPI3_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1MQV1_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0C7T8J1_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1MP06_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1MXY9_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0S2YQW9_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0C7TJ32_BALF1-0      cctgaa------------tgaccaca--agagcgccgccttcgtgctgg-
A0A385J8K7_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1MV59_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1MU91_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1MM94_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0U3U737_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0C7TLW1_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A1P7TZL6_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
K9UT94_BALF1-01         cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
P0CK58_BALF1-01         cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
P0CK59_BALF1-01         cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A0C7TUX3_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
A0A2S1MTH2_BALF1-0      cctgga------------tgaccaca--agagcgccgccttcgtgctgg-
Q91HI3_BALF1-01         cctgga------------tgaccacg--agagcgcggccttcgttctgg-
Q99F65_BALF1-01         cctgga------------tgaccaca--gaagtgcagccttcgttctgg-
H3ALX7_vNR13-01         gctgga------------ggagaatg--gagg-------------ctgg-
Q9DH00_vNR13-01         gttgcg------------ggagcacg--gcgg-------------atgg-
Q9DH00_vNR13-02         gttgcg------------ggagcacg--gcgg-------------atgg-
A0A8C7EHJ2_vNR13-0      gctcga------------ggcgcacg--gcgg-------------atgg-
A0A8C2U8D6_vNR13-0      gatgga------------ggagcacg--gcgg-------------atgg-
Q90343_vNR13-01         gatgga------------ggagcacg--gcgg-------------atgg-
A0A674GY73_vNR13-0      gctgga------------ggcgcacg--gcgg-------------atgg-
A0A8C3KMB5_vNR13-0      gctgga------------ggcgcacg--gcgg-------------atgg-
A0A8D0KT43_vNR13-0      gctgga------------ggcgcacg--gcgg-------------atgg-
A0A663ECE3_vNR13-0      gctgga------------ggcgcacg--gcgg-------------atgg-
A0A8C4V604_vNR13-0      gctgga------------ggcgcacg--gcgg-------------atgg-
A0A8B9GHZ4_vNR13-0      gctgga------------ggctcacg--gcgg-------------atgg-
A0A672TYX3_vNR13-0      gctgga------------ggcgcacg--gcgg-------------atgg-
A0A8C5RRS8_vNR13-0      gctgga------------ggcgcacg--gcgg-------------ctgg-
A0A8C6YHI4_vNR13-0      gctgga------------ggcgcacg--gcgg-------------ctgg-
A0A8D0KNJ6_vNR13-0      gctgga------------ggcgcacg--gagg-------------ctgg-
A0A670KGT8_vNR13-0      gctgga------------ggcgcacg--gcgg-------------ctgg-
A0A8D2LWG1_vNR13-0      gctgga------------ggcgcacg--gcgg-------------ctgg-
A0A8D0L3Y5_vNR13-0      gctgga------------ggcgaacg--gagg-------------ctgg-
A0A8C8VNX1_vNR13-0      gctgga------------ggcacacg--gcgg-------------ctgg-
A0A8C3SNB5_vNR13-0      gctgga------------ggcgcacg--gcgg-------------ctgg-
A0A8C4VQB8_vNR13-0      gctgga------------ggcgcacg--gcgg-------------ctgg-
A0A8C3IX63_vNR13-0      gctgga------------ggcgcacg--gcgg-------------ctgg-
A0A674KEW6_vNR13-0      gctgga------------ggcgcacg--gcgg-------------ctgg-
A1BM64_A9-01            aataag------------ctccacccagaaggtttt------ttttcggg
Q2VSG7_A9-01            aataag------------ctccacccagaaggtttt------ttttcggg
A0A1L2JVL1_A9-01        attcaa---------------cagag--aaactctt---------ctgga
O36423_A9-01            attcaa---------------cagag--aaactctt---------ctgga
Q1XBS8_VBCL2-01         cctagacatctttacgagagccactgtccaggctttgaatgttaattggt
Q1XBS6_VBCL2-01         cctagacatctttacgagagccactgtccaggctttgaatgttaattggt
Q1XBS7_VBCL2-01         cctagacatctttacgagagccactgtccaggctttgaatgttaattggt
Q99D15_VBCL2-01         cttagacatctttacgagagccactgtccaggctttgaatgttaattggt
Q9WH78_VBCL2-01         cttagacatctttacgagagccactgtccaggctttgaatgttaattggt
P89884_M11-01           atcatg------------aattattg--aacgattgca----tgacacac
B1PZP0_M11-01           atcatg------------aattattg--aacgattgca----tgacacac
A0A6M4EIA3_M11-01       atcatg------------aattattg--aacgattgca----tgacacac
D0U1R1_M11-01           aacatg------------atttattg--aacgaataca----tgacacag
Q9Q5K8_BHRF1-01         -ttaga------------agccagcg--aaggtcttga----tggttgga
Q9WGB5_BHRF1-01         -ttaga------------agccagcg--aaggtcttga----tggttgga
A0A0S0DHY9_BHRF1-0      -ttaga------------agccagcg--aaggccttga----tgcttgga
Q8UZJ4_BHRF1-01         -ttaga------------agccagcg--aaggccttga----tgcttgga
Q9IHR2_BHRF1-01         -ttgga------------agccagcg--aaggcctgga----tgcttgga
A0A0S2YQS0_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4F2_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2S1N164_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2S1MYK7_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A410IGR6_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A4D6QZG6_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4C5_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2S1MW70_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A3R5TSC7_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A451G5Y6_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A3R5U6U7_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2S1MWX4_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2S1MX38_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A451G617_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A4D6QS84_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A4D6R7N0_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4M5_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4H8_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4I4_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7TQI4_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A3R5UEL7_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4I0_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A3R5X5H4_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0B6VHG4_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4D6_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7U1E2_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2S1N3G0_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
V5KUE2_BHRF1-02         -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A4D6TWZ3_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A385J9R2_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7T924_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7T6R4_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A385J8Q6_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A4D6TV66_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7T306_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A385J7D0_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A4D6R3D4_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0X9C4Q9_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0X8YIW3_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A4D6QKL8_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A3R5TRD4_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A385J922_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4F8_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4E3_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2H4Z4D9_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
K9UTF7_BHRF1-01         -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7TWM2_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2D1LYW3_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7TK05_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
P03182_BHRF1-01         -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A410I865_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A385JAL1_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2S1N3U3_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2S1MNB9_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A2S1MMY2_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0S2YRE8_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7TX82_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7TTN2_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7TNT4_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
A0A0C7SXB3_BHRF1-0      -ttaga------------agccagcg--aaggcctgga----tggttgga
K9UTN7_BHRF1-01         -ttaga------------agccagcg--aaggcctgga----tggttgga
V5KU29_BHRF1-02         -ttaga------------agccagcg--aaggcctgga----tggttgga
                                                                          

P90504_ORF16-01         ------------cg----aggcctgaaggcgta-----------------
F5HGJ3_ORF16-01         ------------cg----aggcctgaaggcgta-----------------
Q76RI8_ORF16-01         ------------cg----aggcctgaaggcgta-----------------
Q99F66_BALF1-01         ------------gggccaccgcccactacctgg-----------------
A0A4D6QN24_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A385JB67_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A4D6R4T3_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A385J7X7_BALF1-0      ------------gggcaatagcccactacctgg-----------------
A0A0C7TV67_BALF1-0      ------------gggcaatagcccactacctgg-----------------
A0A2S1N1Z2_BALF1-0      ------------gggcaatagcccactacctgg-----------------
A0A2S1N2H2_BALF1-0      ------------gggcaatagcccactacctgg-----------------
A0A4D6TWI9_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A4D6R8R0_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A3R5WV36_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A4D6RFR1_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A4D6RC31_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A4D6RBY3_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A3R5WYW3_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A3R5WNA2_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A075FFB0_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A075FCZ0_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A410I1F1_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
U5YUM6_BALF1-01         ------------gggcaatcgcccactacctgg-----------------
A0A4D6RE52_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A7G1IXW1_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A0A8IKW4_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A4D6R8J3_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A2S1MZQ8_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A385JAB4_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A4D6QXN1_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A4D6QMD2_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A410J0D8_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A410I9N0_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A3R5ZJV6_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A3R5WKR1_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A0U3UKR9_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A2D1LYV4_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
Q91HV2_BALF1-01         ------------gggcaatcgcccactacctgg-----------------
A0A0C7TPI3_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A2S1MQV1_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A0C7T8J1_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A2S1MP06_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A2S1MXY9_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A0S2YQW9_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A0C7TJ32_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A385J8K7_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A2S1MV59_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A2S1MU91_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A2S1MM94_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A0U3U737_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A0C7TLW1_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A1P7TZL6_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
K9UT94_BALF1-01         ------------gggcaatcgcccactacctgg-----------------
P0CK58_BALF1-01         ------------gggcaatcgcccactacctgg-----------------
P0CK59_BALF1-01         ------------gggcaatcgcccactacctgg-----------------
A0A0C7TUX3_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
A0A2S1MTH2_BALF1-0      ------------gggcaatcgcccactacctgg-----------------
Q91HI3_BALF1-01         ------------gggccatcgcccactacctgg-----------------
Q99F65_BALF1-01         ------------gggccatcgcccactacctgg-----------------
H3ALX7_vNR13-01         ------------g-----atggattctacaaat-----------------
Q9DH00_vNR13-01         ------------g-----acggattctgtcgct-----------------
Q9DH00_vNR13-02         ------------gtaagcacgg----------------------------
A0A8C7EHJ2_vNR13-0      ------------g-----atggcttccatcact-----------------
A0A8C2U8D6_vNR13-0      ------------g-----atggcttctgtcgct-----------------
Q90343_vNR13-01         ------------g-----atggcttctgtcgct-----------------
A0A674GY73_vNR13-0      ------------g-----atggcttctgtcgct-----------------
A0A8C3KMB5_vNR13-0      ------------g-----acggcttctgtcgct-----------------
A0A8D0KT43_vNR13-0      ------------g-----atggcttctgtcgct-----------------
A0A663ECE3_vNR13-0      ------------g-----atggcttctgtcgct-----------------
A0A8C4V604_vNR13-0      ------------g-----atggcttctgtcgct-----------------
A0A8B9GHZ4_vNR13-0      ------------g-----atggcttctgccgct-----------------
A0A672TYX3_vNR13-0      ------------g-----atggcttctgccgct-----------------
A0A8C5RRS8_vNR13-0      ------------g-----atggcttctaccact-----------------
A0A8C6YHI4_vNR13-0      ------------g-----atggcttctaccact-----------------
A0A8D0KNJ6_vNR13-0      ------------g-----atggcttctatcact-----------------
A0A670KGT8_vNR13-0      ------------g-----atggcttctatcact-----------------
A0A8D2LWG1_vNR13-0      ------------g-----atggcttctaccact-----------------
A0A8D0L3Y5_vNR13-0      ------------g-----atggcttctatcact-----------------
A0A8C8VNX1_vNR13-0      ------------g-----atggcttctgtcatt-----------------
A0A8C3SNB5_vNR13-0      ------------g-----atggcttctgtcatt-----------------
A0A8C4VQB8_vNR13-0      ------------g-----atggcttctgtcact-----------------
A0A8C3IX63_vNR13-0      ------------g-----atggcttctgtcatt-----------------
A0A674KEW6_vNR13-0      ------------g-----atggcttctgtcatt-----------------
A1BM64_A9-01            accattac----aagaagattgaaagca----------------------
Q2VSG7_A9-01            accattac----aagaagattgaaagca----------------------
A0A1L2JVL1_A9-01        atgaccacttgaaaaaactcaaacaaa-----------------------
O36423_A9-01            atgaccacttgaaaaaactcaaacaaa-----------------------
Q1XBS8_VBCL2-01         ttttgc------aggaaggtgggtggccggctcttgcatcattctgcaag
Q1XBS6_VBCL2-01         ttttgc------aggaaggtgggtggccggctcttgcatcattctgcaag
Q1XBS7_VBCL2-01         ttttgc------aggaaggtgggtggccggctcttgcatcattctgcaag
Q99D15_VBCL2-01         ttttac------aggaaggtgggtggccggcccttgcatcattctgcaag
Q9WH78_VBCL2-01         ttttac------aggaaggtgggtggccggcccttgcatcattctgcaag
P89884_M11-01           ttttttattgaaaacaatttaatgaaccatttt-----------------
B1PZP0_M11-01           ttttttattgaaaacaatttaatgaaccatttt-----------------
A0A6M4EIA3_M11-01       ttttttattgaaaacaatttaatgaaccatttt-----------------
D0U1R1_M11-01           ttttttattgaaaacaatttaatgaactatttt-----------------
Q9Q5K8_BHRF1-01         ttggtc------aacatgggggctggcctgctg-----------------
Q9WGB5_BHRF1-01         ttggtc------aacatgggggctggcctgctg-----------------
A0A0S0DHY9_BHRF1-0      ttcacc------agcaaggtggctggccttctt-----------------
Q8UZJ4_BHRF1-01         ttcacc------agcaaggcggctggccttctt-----------------
Q9IHR2_BHRF1-01         ttcatc------aacagggtggctggactggtc-----------------
A0A0S2YQS0_BHRF1-0      ttcatc------aacagggtggctggtctacat-----------------
A0A2H4Z4F2_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2S1N164_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2S1MYK7_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A410IGR6_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A4D6QZG6_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2H4Z4C5_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2S1MW70_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A3R5TSC7_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A451G5Y6_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A3R5U6U7_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2S1MWX4_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2S1MX38_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A451G617_BHRF1-0      ttcatc------aacagggcggctggactacat-----------------
A0A4D6QS84_BHRF1-0      ttcatc------aacagggcggctggtctacag-----------------
A0A4D6R7N0_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2H4Z4M5_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2H4Z4H8_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2H4Z4I4_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7TQI4_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A3R5UEL7_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2H4Z4I0_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A3R5X5H4_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0B6VHG4_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2H4Z4D6_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7U1E2_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2S1N3G0_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
V5KUE2_BHRF1-02         ttcatc------aacagggcggctggtctacat-----------------
A0A4D6TWZ3_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A385J9R2_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7T924_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7T6R4_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A385J8Q6_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A4D6TV66_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7T306_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A385J7D0_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A4D6R3D4_BHRF1-0      ttcatc------aacagggcagctggtctacat-----------------
A0A0X9C4Q9_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0X8YIW3_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A4D6QKL8_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A3R5TRD4_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A385J922_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2H4Z4F8_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2H4Z4E3_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2H4Z4D9_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
K9UTF7_BHRF1-01         ttcatc------aacagggcggctggtctacat-----------------
A0A0C7TWM2_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2D1LYW3_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7TK05_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
P03182_BHRF1-01         ttcatc------aacagggcggctggtctacat-----------------
A0A410I865_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A385JAL1_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2S1N3U3_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2S1MNB9_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A2S1MMY2_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0S2YRE8_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7TX82_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7TTN2_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7TNT4_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
A0A0C7SXB3_BHRF1-0      ttcatc------aacagggcggctggtctacat-----------------
K9UTN7_BHRF1-01         ttcatc------aacagggcggctggtctacat-----------------
V5KU29_BHRF1-02         ttcatc------aacagggcggctggtctacat-----------------
                                                                          

P90504_ORF16-01         -ttgtacacaggtgctt-----------accagaagaaggggacggagaa
F5HGJ3_ORF16-01         -ttgtacacaggtgctt-----------accagaagaaggggacggagaa
Q76RI8_ORF16-01         -ttgtacacaggtgctt-----------accagaagaaggggacggagaa
Q99F66_BALF1-01         -ccctctat---cgccg-----------tgtctggtttg----ccaggat
A0A4D6QN24_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A385JB67_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6R4T3_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A385J7X7_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A0C7TV67_BALF1-0      -ccctctat---cgcag-----------aatctggtttg----cgaggct
A0A2S1N1Z2_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2S1N2H2_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6TWI9_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6R8R0_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A3R5WV36_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6RFR1_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6RC31_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6RBY3_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A3R5WYW3_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A3R5WNA2_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A075FFB0_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A075FCZ0_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A410I1F1_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
U5YUM6_BALF1-01         -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6RE52_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A7G1IXW1_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A0A8IKW4_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6R8J3_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2S1MZQ8_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A385JAB4_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6QXN1_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A4D6QMD2_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A410J0D8_BALF1-0      -ccctctat---cgcag-----------actctggtttg----tgaggct
A0A410I9N0_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A3R5ZJV6_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A3R5WKR1_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A0U3UKR9_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2D1LYV4_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
Q91HV2_BALF1-01         -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A0C7TPI3_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2S1MQV1_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A0C7T8J1_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2S1MP06_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2S1MXY9_BALF1-0      -ccctctat---cgcag-----------accctggtttg----cgaggct
A0A0S2YQW9_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A0C7TJ32_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A385J8K7_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2S1MV59_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2S1MU91_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2S1MM94_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A0U3U737_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A0C7TLW1_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A1P7TZL6_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
K9UT94_BALF1-01         -ccctctat---cgcag-----------actctggtttg----cgaggct
P0CK58_BALF1-01         -ccctctat---cgcag-----------actctggtttg----cgaggct
P0CK59_BALF1-01         -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A0C7TUX3_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
A0A2S1MTH2_BALF1-0      -ccctctat---cgcag-----------actctggtttg----cgaggct
Q91HI3_BALF1-01         -ccctgtac---cggag-----------actctggtttg----cgaggat
Q99F65_BALF1-01         -ccctgtac---cgcag-----------actctggtttg----cgaggat
H3ALX7_vNR13-01         -tttttgaaagaagtga-----------tc-------------attacca
Q9DH00_vNR13-01         -tcttcgcccgttttgg-----------tcctgggctgg----gagaggc
Q9DH00_vNR13-02         -----------------------------cacgggcggg----catgagc
A0A8C7EHJ2_vNR13-0      -tctt---cagacagga-----------ctctcaacccg----ctgagca
A0A8C2U8D6_vNR13-0      -tcttcggcagacatgg-----------ctcccaaccag----ctgacca
Q90343_vNR13-01         -tcttcggcagacatgg-----------ctcccaaccag----ctgacca
A0A674GY73_vNR13-0      -tctttggcagacacgg-----------ctcggaggcgg----ccgagca
A0A8C3KMB5_vNR13-0      -tcttcggcgggcacgg-----------ctcccagacgg----ctgacca
A0A8D0KT43_vNR13-0      -tctttggcggacacgg-----------ctcccagacgg----ctgacca
A0A663ECE3_vNR13-0      -tcttcggcagacatgg-----------ctcccagccgg----ctgacca
A0A8C4V604_vNR13-0      -tcttcggcagacacgg-----------ctcccagccgg----ccgacca
A0A8B9GHZ4_vNR13-0      -tcttcggcagacaggg-----------atctgagacgg----ctgagca
A0A672TYX3_vNR13-0      -tcttcagtagacaggg-----------ctccgagacag----ctgagca
A0A8C5RRS8_vNR13-0      -tcttcaataagcacgg-----------ctcggatgcag----ctgacca
A0A8C6YHI4_vNR13-0      -tcttcaataagcacgg-----------ctcggatgcag----ctgacca
A0A8D0KNJ6_vNR13-0      -tcttcaataagcatgg-----------ctctgatgcgg----ccgagca
A0A670KGT8_vNR13-0      -tcttcaacaaacatgg-----------ctcggatgcag----ctgacca
A0A8D2LWG1_vNR13-0      -tcttcaataagcatga-----------ctcggatgcag----ctgacca
A0A8D0L3Y5_vNR13-0      -tcttcaacaaacatgg-----------ctctcaaccaa----ctgacca
A0A8C8VNX1_vNR13-0      -tcttcaatggacatgg-----------ctctcaaccaa----gtgacca
A0A8C3SNB5_vNR13-0      -tcttcaagggacatgg-----------ttctcaaccaa----atgacca
A0A8C4VQB8_vNR13-0      -tcttcaatggacatgg-----------ctctcaaccaa----ctgacca
A0A8C3IX63_vNR13-0      -tcttcaatggacatgg-----------ctctcaaccaa----ctgacca
A0A674KEW6_vNR13-0      -tcttcaatggacatgg-----------ctctcaaccaa----ctgacca
A1BM64_A9-01            -tcatagaggcacatatagttccctggactctctcgc------agcggaa
Q2VSG7_A9-01            -tcatagaggcacatatagttccctggactctctcgc------agcggaa
A0A1L2JVL1_A9-01        -tagtcaagtgccacatcgtgccctggaccctgggac------cg--aga
O36423_A9-01            -tagtcaagtgccacatcgtgccctggaccctgggac------cg--aga
Q1XBS8_VBCL2-01         gtggttaatagcccaag-----------cccccgctc------ca--gat
Q1XBS6_VBCL2-01         gtggttaatagcccaag-----------cccccgctc------ca--gat
Q1XBS7_VBCL2-01         gtggttaatagcccaag-----------cccccgctc------ca--gat
Q99D15_VBCL2-01         gtggttaatagcccaag-----------cccccgctc------ca--gat
Q9WH78_VBCL2-01         gtggttaatagcccaag-----------cccccgctc------ca--gat
P89884_M11-01           -ccattagaagacatat-----------ttttggcac------agagaaa
B1PZP0_M11-01           -ccattagaagacatat-----------ttttggcac------agagaaa
A0A6M4EIA3_M11-01       -ccattagaagacatat-----------ttttggcac------agagaaa
D0U1R1_M11-01           -tcccttgaagacacat-----------tttgtacac------agacaaa
Q9Q5K8_BHRF1-01         -tcctgagaggcaaccc-----------ttctggcac------ca--gaa
Q9WGB5_BHRF1-01         -tcctgagaggcaaccc-----------ttctggcac------ca--gaa
A0A0S0DHY9_BHRF1-0      -tactgaggggcaaccg-----------ttcaggcac------tg--gaa
Q8UZJ4_BHRF1-01         -tactgaggggcaaccg-----------ttcaaacac------cg--gaa
Q9IHR2_BHRF1-01         -taattaggagcgactc-----------tcttggctc------ca--caa
A0A0S2YQS0_BHRF1-0      -taattgaagacaacat-----------tcctggctc------ca--gaa
A0A2H4Z4F2_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2S1N164_BHRF1-0      -taattgaagacaactt-----------tcctggatc------ca--gaa
A0A2S1MYK7_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A410IGR6_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A4D6QZG6_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2H4Z4C5_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2S1MW70_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A3R5TSC7_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A451G5Y6_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A3R5U6U7_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2S1MWX4_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2S1MX38_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A451G617_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A4D6QS84_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A4D6R7N0_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2H4Z4M5_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2H4Z4H8_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2H4Z4I4_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7TQI4_BHRF1-0      -taattgaaaacaacat-----------tcctggctc------ca--gaa
A0A3R5UEL7_BHRF1-0      -taattgaaaacaacat-----------tcctggctc------ca--gaa
A0A2H4Z4I0_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A3R5X5H4_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0B6VHG4_BHRF1-0      -taattgaagacaacat-----------tcctggctc------ca--gaa
A0A2H4Z4D6_BHRF1-0      -taattgaagacaacat-----------tcctggctc------ca--gaa
A0A0C7U1E2_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2S1N3G0_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
V5KUE2_BHRF1-02         -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A4D6TWZ3_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A385J9R2_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7T924_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7T6R4_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A385J8Q6_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A4D6TV66_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7T306_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A385J7D0_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A4D6R3D4_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0X9C4Q9_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0X8YIW3_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A4D6QKL8_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A3R5TRD4_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A385J922_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2H4Z4F8_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2H4Z4E3_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2H4Z4D9_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
K9UTF7_BHRF1-01         -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7TWM2_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2D1LYW3_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7TK05_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
P03182_BHRF1-01         -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A410I865_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A385JAL1_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2S1N3U3_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A2S1MNB9_BHRF1-0      -taattgaagacaacat-----------tcctggata------ca--gaa
A0A2S1MMY2_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0S2YRE8_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7TX82_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7TTN2_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7TNT4_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
A0A0C7SXB3_BHRF1-0      -taattgaagacaacat-----------tcctggatc------ca--gaa
K9UTN7_BHRF1-01         -taattgaagacaacat-----------tcctggatc------ca--gaa
V5KU29_BHRF1-02         -taattgaagacaacat-----------tcctggatc------ca--gaa
                                                                          

P90504_ORF16-01         tgacagcgctattgggaagcattgcattattggccactatattggcagcg
F5HGJ3_ORF16-01         tgacagcgctattgggaagcattgcattattggccactatattggcagcg
Q76RI8_ORF16-01         tgacagcgctattgggaagcattgcattattggccactatattggcagcg
Q99F66_BALF1-01         tggcggcctgcc----cag-gtcgctgagacgccaat--tccctgtaaca
A0A4D6QN24_BALF1-0      gggcggcatgcc----aat-atcgctgagacgtcagt--tccccgtgacg
A0A385JB67_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--ttcccgtgacg
A0A4D6R4T3_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A385J7X7_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A0C7TV67_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1N1Z2_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1N2H2_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A4D6TWI9_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A4D6R8R0_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A3R5WV36_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A4D6RFR1_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A4D6RC31_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcggt--tccccgtgacg
A0A4D6RBY3_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A3R5WYW3_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A3R5WNA2_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A075FFB0_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A075FCZ0_BALF1-0      gggcggcatgcc----aag-atcgctgaaacgtcagt--tccccgtgacg
A0A410I1F1_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
U5YUM6_BALF1-01         gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A4D6RE52_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A7G1IXW1_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A0A8IKW4_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A4D6R8J3_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1MZQ8_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A385JAB4_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A4D6QXN1_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A4D6QMD2_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A410J0D8_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A410I9N0_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A3R5ZJV6_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A3R5WKR1_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A0U3UKR9_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2D1LYV4_BALF1-0      gggcggcatgcc----aag-atcgctgagatgtcagt--tccccgtgacg
Q91HV2_BALF1-01         gggcggcatgcc----aag-atcgctgagatgtcagt--tccccgtgacg
A0A0C7TPI3_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1MQV1_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A0C7T8J1_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1MP06_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1MXY9_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A0S2YQW9_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A0C7TJ32_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A385J8K7_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1MV59_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1MU91_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1MM94_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A0U3U737_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A0C7TLW1_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A1P7TZL6_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
K9UT94_BALF1-01         gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
P0CK58_BALF1-01         gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
P0CK59_BALF1-01         gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A0C7TUX3_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
A0A2S1MTH2_BALF1-0      gggcggcatgcc----aag-atcgctgagacgtcagt--tccccgtgacg
Q91HI3_BALF1-01         gggcggcatgcc----aag-gtcgctgagacgtcagt--tccccgtgaga
Q99F65_BALF1-01         gggcggcatgcc----aag-atcgctgagacgccagt--tccccgtgaca
H3ALX7_vNR13-01         ggagtccactgt----acgaaatgctttaatggca-----g-cagctggg
Q9DH00_vNR13-01         gagtcaaacctt----ccctcttggtctcatcgtcgc--tg-cagccgga
Q9DH00_vNR13-02         gg--------------ctcgtttgg----gtcgccgg--tgtctgccaga
A0A8C7EHJ2_vNR13-0      gagcaataccat----aagcaatgccataatggca-----g-cggcaggg
A0A8C2U8D6_vNR13-0      gaacagtacctt----aagcaatgctatcatggca-----g-cagcaggg
Q90343_vNR13-01         gaacagtacctt----aagcaatgctatcatggca-----g-cagcaggg
A0A674GY73_vNR13-0      gagcagcaccat----cggcaatgccatcatggcagc--gg-cggcgggc
A0A8C3KMB5_vNR13-0      gagcagcaccat----aagcaacgccatcatggcc-----g-cagcgggg
A0A8D0KT43_vNR13-0      gagcagtaccat----aagcaatgccatcatggct-----g-cagcgggc
A0A663ECE3_vNR13-0      gagcagtaccat----aagcaatgccatcatggct-----g-cggcgggg
A0A8C4V604_vNR13-0      gagcagcaccat----aagcaatgcaatcatggcc-----g-cagcgggg
A0A8B9GHZ4_vNR13-0      gaacagtaccat----aagcaacgcaatcatggcc-----g-cagcgggg
A0A672TYX3_vNR13-0      gagcagtaccat----aagcaacgcgatcatggcc-----g-cagcagga
A0A8C5RRS8_vNR13-0      gaacagcactat----cagcaatgcaattatggcg-----g-cagcagga
A0A8C6YHI4_vNR13-0      gaacagcactat----cagcaatgccattatggca-----g-cggcagga
A0A8D0KNJ6_vNR13-0      gaacagtgccat----aagcaacgctatcatggcg-----g-ccgcaggg
A0A670KGT8_vNR13-0      gaacagtaccat----aagcaatgctataatggcg-----g-cagctggc
A0A8D2LWG1_vNR13-0      gagcagcaccat----aagcaatgccatcatggca-----g-cggcaggg
A0A8D0L3Y5_vNR13-0      gaacagtaccat----aagcaatgctataatggcg-----g-cagcaggg
A0A8C8VNX1_vNR13-0      gcacagtaccat----aagcagtgctataatggca-----g-cagcaggc
A0A8C3SNB5_vNR13-0      gagcagtaccat----aagcagtgctatcatggca-----g-cagcaggg
A0A8C4VQB8_vNR13-0      gagcagtaccat----aagcagtgctatcatggca-----g-cagcaggg
A0A8C3IX63_vNR13-0      gaacagtaccat----aagcagtgctatcatggca-----g-cagcaggg
A0A674KEW6_vNR13-0      gaacagtaccat----aagcagtgctatcatggca-----g-cagcaggg
A1BM64_A9-01            actcaagg-------------agccttttccactaaaaatgaggga----
Q2VSG7_A9-01            actcaagg-------------agccttttccactaaaaatgaggga----
A0A1L2JVL1_A9-01        gatccaaaaccg----aaacagcgtccatttgataaattacctagcgcct
O36423_A9-01            gatccaaaaccg----aaacagcgtccatttgataaattacctagcgcct
Q1XBS8_VBCL2-01         ggttatttccca----tgcttgccatctccggcctggta--ctgac----
Q1XBS6_VBCL2-01         ggttatttccca----tgcttgccatctccggcctggta--ctgac----
Q1XBS7_VBCL2-01         ggttatttccca----tgcttgccatctccggcctggta--ctgac----
Q99D15_VBCL2-01         ggttatttccca----tgtttgccatctccggcctggta--ctgac----
Q9WH78_VBCL2-01         ggttatttccca----tgtttgccatctccggcctggta--ctgac----
P89884_M11-01           attccagaccac----tggctttacattcttgttgcatgccctggc----
B1PZP0_M11-01           attccagaccac----tggctttacattcttgttgcatgccctggc----
A0A6M4EIA3_M11-01       attccagaccac----tggctttacattcttgttgcatgccctggc----
D0U1R1_M11-01           attccataacat----gggatttagccttgcattgagtatcctgtg----
Q9Q5K8_BHRF1-01         gctcaaga--------tggactatcgtttttactgga----ctgac----
Q9WGB5_BHRF1-01         gctcaaga--------tggactatcgtttttactgga----ctgac----
A0A0S0DHY9_BHRF1-0      gccccgga--------tggactgcatttctagctgga----ctaac----
Q8UZJ4_BHRF1-01         gccccata--------ttgactgcatttttagctgga----ctaac----
Q9IHR2_BHRF1-01         actctaga--------tggactttgctttttgccgga----ctgac----
A0A0S2YQS0_BHRF1-0      gctttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4F2_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2S1N164_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2S1MYK7_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A410IGR6_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A4D6QZG6_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4C5_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2S1MW70_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A3R5TSC7_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A451G5Y6_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A3R5U6U7_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2S1MWX4_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2S1MX38_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A451G617_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A4D6QS84_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A4D6R7N0_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4M5_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4H8_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4I4_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0C7TQI4_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A3R5UEL7_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4I0_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A3R5X5H4_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0B6VHG4_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4D6_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0C7U1E2_BHRF1-0      ggtttagc--------tggactttgtttctcgctgga----ctgac----
A0A2S1N3G0_BHRF1-0      ggtttagc--------tggactttgtttctcgctgga----ctgac----
V5KUE2_BHRF1-02         ggtttagc--------tggactttgtttctcgctgga----ctgac----
A0A4D6TWZ3_BHRF1-0      ggtttagc--------tggactttgtttctcgctgga----ctgac----
A0A385J9R2_BHRF1-0      ggtttagc--------tggactttgtttctcgctgga----ctgac----
A0A0C7T924_BHRF1-0      agtttagc--------tggactttgtttctcgctgga----ctgac----
A0A0C7T6R4_BHRF1-0      ggtttagc--------tggactttgtttctcgctgga----ctgac----
A0A385J8Q6_BHRF1-0      ggtttagc--------tggactttgtttctcgctgga----ctgac----
A0A4D6TV66_BHRF1-0      ggtttagc--------tggactttgtttctcgctgga----ctgac----
A0A0C7T306_BHRF1-0      ggtttagc--------tggactttgtttctcgctgga----ctgac----
A0A385J7D0_BHRF1-0      ggtttagc--------tggactttgtttctcgctgga----ctgac----
A0A4D6R3D4_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0X9C4Q9_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0X8YIW3_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A4D6QKL8_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A3R5TRD4_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A385J922_BHRF1-0      gttttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4F8_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4E3_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2H4Z4D9_BHRF1-0      ggtttatc--------tggactttgtttcttgctgga----ctgac----
K9UTF7_BHRF1-01         ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0C7TWM2_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2D1LYW3_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0C7TK05_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
P03182_BHRF1-01         ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A410I865_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A385JAL1_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2S1N3U3_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2S1MNB9_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A2S1MMY2_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0S2YRE8_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0C7TX82_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0C7TTN2_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0C7TNT4_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
A0A0C7SXB3_BHRF1-0      ggtttagc--------tggactttgtttcttgctgga----ctgac----
K9UTN7_BHRF1-01         ggtttagc--------tggactttgtttcttgctgga----ctgac----
V5KU29_BHRF1-02         ggtttagc--------tggactttgtttcttgctgga----ctgac----
                                                                          

P90504_ORF16-01         gtcgcgatg--------------------------agcagga--------
F5HGJ3_ORF16-01         gtcgcgatg--------------------------agcagga--------
Q76RI8_ORF16-01         gtcgcgatg--------------------------agcagga--------
Q99F66_BALF1-01         tgggctat---------------------------cgccagcctgtcgga
A0A4D6QN24_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A385JB67_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A4D6R4T3_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A385J7X7_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A0C7TV67_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1N1Z2_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1N2H2_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A4D6TWI9_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A4D6R8R0_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A3R5WV36_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A4D6RFR1_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A4D6RC31_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A4D6RBY3_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A3R5WYW3_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A3R5WNA2_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A075FFB0_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A075FCZ0_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A410I1F1_BALF1-0      tgggccct---------------------------ggccagcctgactga
U5YUM6_BALF1-01         tgggccct---------------------------ggccagcctgactga
A0A4D6RE52_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A7G1IXW1_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A0A8IKW4_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A4D6R8J3_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1MZQ8_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A385JAB4_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A4D6QXN1_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A4D6QMD2_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A410J0D8_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A410I9N0_BALF1-0      tggaccct---------------------------ggccagcctgactga
A0A3R5ZJV6_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A3R5WKR1_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A0U3UKR9_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2D1LYV4_BALF1-0      tgggccct---------------------------ggccagcctgactga
Q91HV2_BALF1-01         tgggccct---------------------------ggccagcctgactga
A0A0C7TPI3_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1MQV1_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A0C7T8J1_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1MP06_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1MXY9_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A0S2YQW9_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A0C7TJ32_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A385J8K7_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1MV59_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1MU91_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1MM94_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A0U3U737_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A0C7TLW1_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A1P7TZL6_BALF1-0      tgggccct---------------------------ggccagcctgactga
K9UT94_BALF1-01         tgggccct---------------------------ggccagcctgactga
P0CK58_BALF1-01         tgggccct---------------------------ggccagcctgactga
P0CK59_BALF1-01         tgggccct---------------------------ggccagcctgactga
A0A0C7TUX3_BALF1-0      tgggccct---------------------------ggccagcctgactga
A0A2S1MTH2_BALF1-0      tgggccct---------------------------ggcaagcctgactga
Q91HI3_BALF1-01         tgggcgct---------------------------ggctggcctgactta
Q99F65_BALF1-01         tgggcgat---------------------------ggccggcctgaccga
H3ALX7_vNR13-01         tttggaat---------------------------agcaggtttagcctt
Q9DH00_vNR13-01         -----------------------------------atcg-ggataacggt
Q9DH00_vNR13-02         -----------------------------------agcgaggagcaccgt
A0A8C7EHJ2_vNR13-0      tttggaat---------------------------agcaggattagcttt
A0A8C2U8D6_vNR13-0      tttggaat---------------------------agcaggattagcttt
Q90343_vNR13-01         tttggaat---------------------------agcaggattagcttt
A0A674GY73_vNR13-0      atcggcat---------------------------ggcaggattggcttt
A0A8C3KMB5_vNR13-0      tttggaat---------------------------agcgggattggcttt
A0A8D0KT43_vNR13-0      tttgggat---------------------------agcaggattggcttt
A0A663ECE3_vNR13-0      tttggaat---------------------------agcaggattggcttt
A0A8C4V604_vNR13-0      ttcggaat---------------------------agcaggattggcttt
A0A8B9GHZ4_vNR13-0      tttggaat---------------------------agcaggattggcttt
A0A672TYX3_vNR13-0      tttggaat---------------------------agcaggattggcttt
A0A8C5RRS8_vNR13-0      ttcggcct---------------------------ggcaggattggcttt
A0A8C6YHI4_vNR13-0      tttggcct---------------------------agcaggattggcttt
A0A8D0KNJ6_vNR13-0      tttggctt---------------------------ggcaggattggcttt
A0A670KGT8_vNR13-0      tttggctt---------------------------ggctggcttggcctt
A0A8D2LWG1_vNR13-0      ttcggtct---------------------------ggcgggattggcttt
A0A8D0L3Y5_vNR13-0      tttggact---------------------------agcaggattggcctt
A0A8C8VNX1_vNR13-0      tttggact---------------------------agcaggattagcttt
A0A8C3SNB5_vNR13-0      tttggact---------------------------agcaggattagctgt
A0A8C4VQB8_vNR13-0      tttggact---------------------------agcagggttagctgt
A0A8C3IX63_vNR13-0      tttggact---------------------------agcgggattagctgt
A0A674KEW6_vNR13-0      tttggact---------------------------agcaggattagctgt
A1BM64_A9-01            agtggttatttttttcaccacagtggcgtccctggtagctatgc--ttct
Q2VSG7_A9-01            agtggttatttttttcaccacagtggcgtccctggtagctatgc--ttct
A0A1L2JVL1_A9-01        tttatttcttaaccgcagcagcttcttgtttgacgctactgctt-ctata
O36423_A9-01            tttatttcttaaccgcagcagcttcttgtttgacgctactgctt-ctata
Q1XBS8_VBCL2-01         tgtgggtgt-----------ggc------------gagaaacatggtaca
Q1XBS6_VBCL2-01         tgtgggtgt-----------ggc------------gagaaacatggtaca
Q1XBS7_VBCL2-01         tgtgggtgt-----------ggc------------gagaaacatggtaca
Q99D15_VBCL2-01         tgtgggtgt-----------ggc------------tagaaatatggtaca
Q9WH78_VBCL2-01         tgtgggtgt-----------tgc------------tagaaatatggtaca
P89884_M11-01           gaaggtgtt-----------gcccaggatatattctgggaatgtgattta
B1PZP0_M11-01           gaaggtgtt-----------gcccaggatatattctgggaatgtgattta
A0A6M4EIA3_M11-01       gaaggtgtt-----------gcccaggatatattctgggaatgtgattta
D0U1R1_M11-01           tcgggcgct-----------gaccaggatatattctggtgatgtgatcta
Q9Q5K8_BHRF1-01         tttaagttt-----------gttagttgtgtg---tagctatat-cttta
Q9WGB5_BHRF1-01         tttaagttt-----------gttagttgtgtg---tagctatat-cttta
A0A0S0DHY9_BHRF1-0      tttaactct-----------cgtagttgtgtg---tagctattt-attta
Q8UZJ4_BHRF1-01         tttaacttt-----------cgtagttgtgtg---tagctatct-cttta
Q9IHR2_BHRF1-01         tttgagtct-----------gttaattgtatg---tagctattt-attta
A0A0S2YQS0_BHRF1-0      tttgagtct-----------gttagttgtatg---tagttattt-attta
A0A2H4Z4F2_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2S1N164_BHRF1-0      tttgagtct-----------gttagttatatg---cagttattt-attta
A0A2S1MYK7_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A410IGR6_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A4D6QZG6_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2H4Z4C5_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2S1MW70_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A3R5TSC7_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A451G5Y6_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A3R5U6U7_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2S1MWX4_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2S1MX38_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A451G617_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A4D6QS84_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A4D6R7N0_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2H4Z4M5_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2H4Z4H8_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2H4Z4I4_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7TQI4_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A3R5UEL7_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2H4Z4I0_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A3R5X5H4_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0B6VHG4_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2H4Z4D6_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7U1E2_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2S1N3G0_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
V5KUE2_BHRF1-02         tttgagtct-----------gttagttatatg---tagttattt-attta
A0A4D6TWZ3_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A385J9R2_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7T924_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7T6R4_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A385J8Q6_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A4D6TV66_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7T306_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A385J7D0_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A4D6R3D4_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0X9C4Q9_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0X8YIW3_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A4D6QKL8_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A3R5TRD4_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A385J922_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2H4Z4F8_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2H4Z4E3_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2H4Z4D9_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
K9UTF7_BHRF1-01         tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7TWM2_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2D1LYW3_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7TK05_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
P03182_BHRF1-01         tttgagtct-----------gttagttatatg---tagttattt-attta
A0A410I865_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A385JAL1_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2S1N3U3_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2S1MNB9_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A2S1MMY2_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0S2YRE8_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7TX82_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7TTN2_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7TNT4_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
A0A0C7SXB3_BHRF1-0      tttgagtct-----------gttagttatatg---tagttattt-attta
K9UTN7_BHRF1-01         tttgagtct-----------gttagttatatg---tagttattt-attta
V5KU29_BHRF1-02         tttgagtct-----------gttagttatatg---tagttattt-attta
                                                                          

P90504_ORF16-01         --------------------gataa------------
F5HGJ3_ORF16-01         --------------------gataa------------
Q76RI8_ORF16-01         --------------------gataa------------
Q99F66_BALF1-01         cttcctg------aaatctttgtaa------------
A0A4D6QN24_BALF1-0      cttcctg------aaatctttgtaa------------
A0A385JB67_BALF1-0      cttcctg------aaatctttgtaa------------
A0A4D6R4T3_BALF1-0      cttcctg------aaatctttgtaa------------
A0A385J7X7_BALF1-0      cttcctg------aaatctttgtaa------------
A0A0C7TV67_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1N1Z2_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1N2H2_BALF1-0      cttcctg------aaatctttgtaa------------
A0A4D6TWI9_BALF1-0      cttcctg------aaatctttgtaa------------
A0A4D6R8R0_BALF1-0      cttcctg------aaatctttgtaa------------
A0A3R5WV36_BALF1-0      cttcctg------aaatctttgtaa------------
A0A4D6RFR1_BALF1-0      cttcctg------aaatctttgtaa------------
A0A4D6RC31_BALF1-0      cttcctg------aaatctttgtaa------------
A0A4D6RBY3_BALF1-0      cttcctg------aaatctttgtaa------------
A0A3R5WYW3_BALF1-0      cttcctg------aaatctttgtaa------------
A0A3R5WNA2_BALF1-0      cttcctg------aaatctttgtaa------------
A0A075FFB0_BALF1-0      cttcctg------aaatctttgtaa------------
A0A075FCZ0_BALF1-0      cttcctg------aaatctttgtaa------------
A0A410I1F1_BALF1-0      cttcctg------aaatctttgtaa------------
U5YUM6_BALF1-01         cttcctg------aaatctttgtaa------------
A0A4D6RE52_BALF1-0      cttcctg------aaatctttgtaa------------
A0A7G1IXW1_BALF1-0      cttcctg------aaatctttgtaa------------
A0A0A8IKW4_BALF1-0      cttcctg------aaatctttgtaa------------
A0A4D6R8J3_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1MZQ8_BALF1-0      cttcctg------aaatctttgtaa------------
A0A385JAB4_BALF1-0      cttcctg------aaatctttgtaa------------
A0A4D6QXN1_BALF1-0      cttcctg------aaatctttgtaa------------
A0A4D6QMD2_BALF1-0      cttcctg------aaatctttgtaa------------
A0A410J0D8_BALF1-0      cttcctg------aaatctttgtaa------------
A0A410I9N0_BALF1-0      cttcctg------aaatctttgtaa------------
A0A3R5ZJV6_BALF1-0      cttcctg------aaatctttgtaa------------
A0A3R5WKR1_BALF1-0      cttcctg------aaatctttgtaa------------
A0A0U3UKR9_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2D1LYV4_BALF1-0      cttcctg------aaatctttgtaa------------
Q91HV2_BALF1-01         cttcctg------aaatctttgtaa------------
A0A0C7TPI3_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1MQV1_BALF1-0      cttcctg------aaatctttgtaa------------
A0A0C7T8J1_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1MP06_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1MXY9_BALF1-0      cttcctg------aaatctttgtaa------------
A0A0S2YQW9_BALF1-0      cttcctg------aaatctttgtaa------------
A0A0C7TJ32_BALF1-0      cttcctg------aaatctttgtaa------------
A0A385J8K7_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1MV59_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1MU91_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1MM94_BALF1-0      cttcctg------aaatctttgtaa------------
A0A0U3U737_BALF1-0      cttcctg------aaatctttgtaa------------
A0A0C7TLW1_BALF1-0      cttcctg------aaatctttgtaa------------
A0A1P7TZL6_BALF1-0      cttcctg------aaatctttgtaa------------
K9UT94_BALF1-01         cttcctg------aaatctttgtaa------------
P0CK58_BALF1-01         cttcctg------aaatctttgtaa------------
P0CK59_BALF1-01         cttcctg------aaatctttgtaa------------
A0A0C7TUX3_BALF1-0      cttcctg------aaatctttgtaa------------
A0A2S1MTH2_BALF1-0      cttcctg------aaatctttgtaa------------
Q91HI3_BALF1-01         cttcctg------aaatctttgtaa------------
Q99F65_BALF1-01         cttcctg------aaatctttgtaa------------
H3ALX7_vNR13-01         cctgtta------gctgtgcgataa------------
Q9DH00_vNR13-01         tctcatc------gtcgtgtggcaattccaatcctaa
Q9DH00_vNR13-02         gcgcggc------gctg-gtag---------------
A0A8C7EHJ2_vNR13-0      tctcttg------gtggtgcggtag------------
A0A8C2U8D6_vNR13-0      tctcttg------gtggtgcggtag------------
Q90343_vNR13-01         tctcttg------gtggtgcggtag------------
A0A674GY73_vNR13-0      cctct---------tggtgcggtag------------
A0A8C3KMB5_vNR13-0      tctcttg------gtggtgcggtag------------
A0A8D0KT43_vNR13-0      tctcttg------gtggtgcggtag------------
A0A663ECE3_vNR13-0      tctcttg------gtggtgcggtag------------
A0A8C4V604_vNR13-0      tctcttg------gtggtgcggtag------------
A0A8B9GHZ4_vNR13-0      tctcttg------gtggtgcggtag------------
A0A672TYX3_vNR13-0      tctcttg------gtggtgcggtag------------
A0A8C5RRS8_vNR13-0      tctcttg------gtggtgcgataa------------
A0A8C6YHI4_vNR13-0      cctcttg------gtggtgcgataa------------
A0A8D0KNJ6_vNR13-0      cctgttg------gcggtgcgataa------------
A0A670KGT8_vNR13-0      cctcctg------gcggtgcgataa------------
A0A8D2LWG1_vNR13-0      cctcttg------gccgtgcgatag------------
A0A8D0L3Y5_vNR13-0      tctcttg------gctgtgcgatag------------
A0A8C8VNX1_vNR13-0      tctcttg------gctgtgcgatag------------
A0A8C3SNB5_vNR13-0      tctcttg------gctgtacgataa------------
A0A8C4VQB8_vNR13-0      tctcttg------gctgtacgatag------------
A0A8C3IX63_vNR13-0      tctcttg------gctgtacgatag------------
A0A674KEW6_vNR13-0      tctcttg------gctgtacgatag------------
A1BM64_A9-01            gttctgtagacgcgcgtggagctag------------
Q2VSG7_A9-01            gttatgcagacgcgcgtggggctag------------
A0A1L2JVL1_A9-01        cttccgaaccactcaaacgaaatga------------
O36423_A9-01            cttccgaaccactcaaacgaaatga------------
Q1XBS8_VBCL2-01         tttt---------------acctaa------------
Q1XBS6_VBCL2-01         tttt---------------acctaa------------
Q1XBS7_VBCL2-01         tttt---------------acctaa------------
Q99D15_VBCL2-01         tttt---------------acctaa------------
Q9WH78_VBCL2-01         tttt---------------acctaa------------
P89884_M11-01           tgtctga------------------------------
B1PZP0_M11-01           tgtctga------------------------------
A0A6M4EIA3_M11-01       tgtctga------------------------------
D0U1R1_M11-01           tgtctga------------------------------
Q9Q5K8_BHRF1-01         tttcta--------gaagacactaa------------
Q9WGB5_BHRF1-01         tttcta--------gaagacactaa------------
A0A0S0DHY9_BHRF1-0      tctctgga-----agaagacgctga------------
Q8UZJ4_BHRF1-01         tctctgga-----agaagacgctga------------
Q9IHR2_BHRF1-01         tctctaga-----ggaagacactaa------------
A0A0S2YQS0_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4F2_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2S1N164_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2S1MYK7_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A410IGR6_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A4D6QZG6_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4C5_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2S1MW70_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A3R5TSC7_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A451G5Y6_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A3R5U6U7_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2S1MWX4_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2S1MX38_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A451G617_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A4D6QS84_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A4D6R7N0_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4M5_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4H8_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4I4_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7TQI4_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A3R5UEL7_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4I0_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A3R5X5H4_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0B6VHG4_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4D6_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7U1E2_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2S1N3G0_BHRF1-0      tctccaga-----ggaagacagtaa------------
V5KUE2_BHRF1-02         tctccaga-----ggaagacactaa------------
A0A4D6TWZ3_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A385J9R2_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7T924_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7T6R4_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A385J8Q6_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A4D6TV66_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7T306_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A385J7D0_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A4D6R3D4_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0X9C4Q9_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0X8YIW3_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A4D6QKL8_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A3R5TRD4_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A385J922_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4F8_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4E3_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2H4Z4D9_BHRF1-0      tctccaga-----ggaagacactaa------------
K9UTF7_BHRF1-01         tctccaga-----ggaagacactaa------------
A0A0C7TWM2_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2D1LYW3_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7TK05_BHRF1-0      tctccaga-----ggaagacactaa------------
P03182_BHRF1-01         tctccaga-----ggaagacactaa------------
A0A410I865_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A385JAL1_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2S1N3U3_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2S1MNB9_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A2S1MMY2_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0S2YRE8_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7TX82_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7TTN2_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7TNT4_BHRF1-0      tctccaga-----ggaagacactaa------------
A0A0C7SXB3_BHRF1-0      tctccaga-----ggaagacactaa------------
K9UTN7_BHRF1-01         tctccaga-----ggaagacactaa------------
V5KU29_BHRF1-02         tctccaga-----ggaagacagtaa------------
                                                             

© 1998-2023Legal notice