Dataset for CDS vNR13 of organism Coturnix japonica

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C2U8D6_vNR13-0      atgccgggctctctgaaggaggagacggcgctgctgctggaggattactt
Q90343_vNR13-01         atgccgggctctctgaaggaggagacggcgctgctgctggaggattactt

A0A8C2U8D6_vNR13-0      ccagcaccgggccggcggggccgcgctgcctcccagcgccacggcggccg
Q90343_vNR13-01         ccagcaccgggccggcggggccgcgctgcctcccagcgccacggcggccg

A0A8C2U8D6_vNR13-0      agctgcggcgggcggcggccgagctggagcgacgggagcggcccttcttc
Q90343_vNR13-01         agctgcggcgggcggcggccgagctggagcgacgggagcggcccttcttc

A0A8C2U8D6_vNR13-0      cgatcctgcgctccgctggcgcgggccgagccgcgggaggcggcggcgct
Q90343_vNR13-01         cgatcctgcgctccgctggcgcgggccgagccgcgggaggcggcggcgct

A0A8C2U8D6_vNR13-0      gctgcggaaggtggcggcgcagctggaggccgacggcggcctgaactggg
Q90343_vNR13-01         gctgcggaaggtggcggcgcagctggagaccgacggcggcctgaactggg
                        **************************** *********************

A0A8C2U8D6_vNR13-0      gccggctgctggcgctcgtggtgttcgccggcacgttggcggcagcgctg
Q90343_vNR13-01         gccggctgctggcgctcgtggtgttcgccggcacgttggcggcagcgctg

A0A8C2U8D6_vNR13-0      accgagagcggctgcgaggaagggccgagccgcctggccgccgcgctgac
Q90343_vNR13-01         gccgagagcgcctgcgaggaagggccgagccgcctggccgccgcgctgac
                         ********* ***************************************

A0A8C2U8D6_vNR13-0      cgcgtacctggccgaggagcagggagagtggatggaggagcacggcggat
Q90343_vNR13-01         cgcgtacctggccgaggagcagggagagtggatggaggagcacggcggat

A0A8C2U8D6_vNR13-0      gggatggcttctgtcgcttcttcggcagacatggctcccaaccagctgac
Q90343_vNR13-01         gggatggcttctgtcgcttcttcggcagacatggctcccaaccagctgac

A0A8C2U8D6_vNR13-0      cagaacagtaccttaagcaatgctatcatggcagcagcagggtttggaat
Q90343_vNR13-01         cagaacagtaccttaagcaatgctatcatggcagcagcagggtttggaat

A0A8C2U8D6_vNR13-0      agcaggattagcttttctcttggtggtgcggtag
Q90343_vNR13-01         agcaggattagcttttctcttggtggtgcggtag

© 1998-2022Legal notice