Dataset for CDS LMW5-HL of organism African swine fever virus

[Download (right click)] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A9JKY0_LMW5HL-01          atggagggagaagagttaatatatcataatatcattaatgaaatactagt
A0A0C5AZD3_LMW5HL-01      atggagggagaagagctcatatatcataatatcattaatgaaatactcgt
A0A7R8V9Y5_LMW5HL-01      atggagggagaagagctcatatatcataatatcattaatgaaatactcgt
A9JLP1_LMW5HL-01          atggagggagaagagttaatatatcataatatcattaatgaaatactagt
D0Q0E8_LMW5HL-01          atggagggagaagagttaatatatcataatatcattaatgaaatactagt
D4I5M9_LMW5HL-01          atggagggagaagagttaatatatcataatatcattaatgaaatactagt
P42485_LMW5HL-01          atggagggagaagagttaatatatcataatatcattaatgaaatactagt
                          *************** * ***************************** **

A9JKY0_LMW5HL-01          gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
A0A0C5AZD3_LMW5HL-01      gggatatattaaatattacatgaatgatatttcagagcatgaacttagcc
A0A7R8V9Y5_LMW5HL-01      gggatatattaaatattacatgaatgatatttcagagcatgaacttagcc
A9JLP1_LMW5HL-01          gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
D0Q0E8_LMW5HL-01          gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
D4I5M9_LMW5HL-01          gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
P42485_LMW5HL-01          gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
                          *** ***************** ******************** *******

A9JKY0_LMW5HL-01          catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
A0A0C5AZD3_LMW5HL-01      cgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttg
A0A7R8V9Y5_LMW5HL-01      cgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttg
A9JLP1_LMW5HL-01          catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
D0Q0E8_LMW5HL-01          catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
D4I5M9_LMW5HL-01          catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
P42485_LMW5HL-01          catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
                          * ** ** *********************************** ******

A9JKY0_LMW5HL-01          aacaaacaggttataattaccttttctcttacgagtgtccaagaaattaa
A0A0C5AZD3_LMW5HL-01      aacaagcaggttacaattaccttttctcttacgagtgcccaagaaattaa
A0A7R8V9Y5_LMW5HL-01      aacaagcaggttacaattaccttttctcttacgagtgcccaagaaattaa
A9JLP1_LMW5HL-01          aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
D0Q0E8_LMW5HL-01          aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
D4I5M9_LMW5HL-01          aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
P42485_LMW5HL-01          aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
                          ***** ******* *********************** ************

A9JKY0_LMW5HL-01          aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
A0A0C5AZD3_LMW5HL-01      aacccagtttactgaggttgtgactgagttgtttaaggatcttatcaact
A0A7R8V9Y5_LMW5HL-01      aacccagtttactgaggttgtgactgagttgtttaaggatcttatcaact
A9JLP1_LMW5HL-01          aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
D0Q0E8_LMW5HL-01          aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
D4I5M9_LMW5HL-01          aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
P42485_LMW5HL-01          aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
                          ************** ************* *********************

A9JKY0_LMW5HL-01          ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
A0A0C5AZD3_LMW5HL-01      ggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtac
A0A7R8V9Y5_LMW5HL-01      ggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtac
A9JLP1_LMW5HL-01          ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
D0Q0E8_LMW5HL-01          ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
D4I5M9_LMW5HL-01          ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
P42485_LMW5HL-01          ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
                          ************************************ ************ 

A9JKY0_LMW5HL-01          tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
A0A0C5AZD3_LMW5HL-01      tgcaaagatgccaacaaccatctggagtccacggtgatcactacggcata
A0A7R8V9Y5_LMW5HL-01      tgcaaagatgccaacaaccatctggagtccacggtgatcactacggcata
A9JLP1_LMW5HL-01          tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
D0Q0E8_LMW5HL-01          tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
D4I5M9_LMW5HL-01          tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
P42485_LMW5HL-01          tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
                          ******** ***** ***********************************

A9JKY0_LMW5HL-01          caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A0A0C5AZD3_LMW5HL-01      caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A0A7R8V9Y5_LMW5HL-01      caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A9JLP1_LMW5HL-01          caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
D0Q0E8_LMW5HL-01          caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
D4I5M9_LMW5HL-01          caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
P42485_LMW5HL-01          caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
                          **************************************************

A9JKY0_LMW5HL-01          aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
A0A0C5AZD3_LMW5HL-01      aagaggagtttttggctttctctctacacagtgacatttattccgtgatt
A0A7R8V9Y5_LMW5HL-01      aagaggagtttttggctttctctctacacagtgacatttattccgtgatt
A9JLP1_LMW5HL-01          aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
D0Q0E8_LMW5HL-01          aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
D4I5M9_LMW5HL-01          aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
P42485_LMW5HL-01          aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
                          ************************************* ************

A9JKY0_LMW5HL-01          tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
A0A0C5AZD3_LMW5HL-01      tttaatattaaatatttcttatctaaattttgtaatcacatgtttttaag
A0A7R8V9Y5_LMW5HL-01      tttaatattaaatatttcttatctaaattttgtaatcacatgtttttaaa
A9JLP1_LMW5HL-01          tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
D0Q0E8_LMW5HL-01          tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
D4I5M9_LMW5HL-01          tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
P42485_LMW5HL-01          tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
                          *********************************************** * 

A9JKY0_LMW5HL-01          atcctgtgtacagttattaagaaactgcaatttgatatag
A0A0C5AZD3_LMW5HL-01      atcctgtgtacatttattaagaaactgcaatttgatctag
A0A7R8V9Y5_LMW5HL-01      atcctgtgtacatttattaagaaactgcaatttgatctag
A9JLP1_LMW5HL-01          atcctgtgtacagttattaagaaactgcaatttgatatag
D0Q0E8_LMW5HL-01          atcctgtgtacagttattaagaaactgcaatttgatatag
D4I5M9_LMW5HL-01          atcctgtgtacagttattaagaaactgcaatttgatatag
P42485_LMW5HL-01          atcctgtgtacagttattaagaaactgcaatttgatatag
                          ************ *********************** ***

© 1998-2024Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice