Dataset for CDS asfarviridae of organism African swine fever virus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0C5AZD3_LMW5HL-      atggagggagaagagctcatatatcataatatcattaatgaaatactcgt
A0A7R8V9Y5_LMW5HL-      atggagggagaagagctcatatatcataatatcattaatgaaatactcgt
A9JKY0_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
A9JLP1_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
D0Q0E8_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
D4I5M9_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
P42485_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
                        *************** * ***************************** **

A0A0C5AZD3_LMW5HL-      gggatatattaaatattacatgaatgatatttcagagcatgaacttagcc
A0A7R8V9Y5_LMW5HL-      gggatatattaaatattacatgaatgatatttcagagcatgaacttagcc
A9JKY0_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
A9JLP1_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
D0Q0E8_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
D4I5M9_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
P42485_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
                        *** ***************** ******************** *******

A0A0C5AZD3_LMW5HL-      cgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttg
A0A7R8V9Y5_LMW5HL-      cgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttg
A9JKY0_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
A9JLP1_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
D0Q0E8_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
D4I5M9_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
P42485_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
                        * ** ** *********************************** ******

A0A0C5AZD3_LMW5HL-      aacaagcaggttacaattaccttttctcttacgagtgcccaagaaattaa
A0A7R8V9Y5_LMW5HL-      aacaagcaggttacaattaccttttctcttacgagtgcccaagaaattaa
A9JKY0_LMW5HL-01        aacaaacaggttataattaccttttctcttacgagtgtccaagaaattaa
A9JLP1_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
D0Q0E8_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
D4I5M9_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
P42485_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
                        ***** ******* *********************** ************

A0A0C5AZD3_LMW5HL-      aacccagtttactgaggttgtgactgagttgtttaaggatcttatcaact
A0A7R8V9Y5_LMW5HL-      aacccagtttactgaggttgtgactgagttgtttaaggatcttatcaact
A9JKY0_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
A9JLP1_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
D0Q0E8_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
D4I5M9_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
P42485_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
                        ************** ************* *********************

A0A0C5AZD3_LMW5HL-      ggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtac
A0A7R8V9Y5_LMW5HL-      ggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtac
A9JKY0_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
A9JLP1_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
D0Q0E8_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
D4I5M9_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
P42485_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
                        ************************************ ************ 

A0A0C5AZD3_LMW5HL-      tgcaaagatgccaacaaccatctggagtccacggtgatcactacggcata
A0A7R8V9Y5_LMW5HL-      tgcaaagatgccaacaaccatctggagtccacggtgatcactacggcata
A9JKY0_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
A9JLP1_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
D0Q0E8_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
D4I5M9_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
P42485_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
                        ******** ***** ***********************************

A0A0C5AZD3_LMW5HL-      caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A0A7R8V9Y5_LMW5HL-      caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A9JKY0_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A9JLP1_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
D0Q0E8_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
D4I5M9_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
P42485_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc

A0A0C5AZD3_LMW5HL-      aagaggagtttttggctttctctctacacagtgacatttattccgtgatt
A0A7R8V9Y5_LMW5HL-      aagaggagtttttggctttctctctacacagtgacatttattccgtgatt
A9JKY0_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
A9JLP1_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
D0Q0E8_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
D4I5M9_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
P42485_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
                        ************************************* ************

A0A0C5AZD3_LMW5HL-      tttaatattaaatatttcttatctaaattttgtaatcacatgtttttaag
A0A7R8V9Y5_LMW5HL-      tttaatattaaatatttcttatctaaattttgtaatcacatgtttttaaa
A9JKY0_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
A9JLP1_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
D0Q0E8_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
D4I5M9_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
P42485_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
                        *********************************************** * 

A0A0C5AZD3_LMW5HL-      atcctgtgtacatttattaagaaactgcaatttgatctag
A0A7R8V9Y5_LMW5HL-      atcctgtgtacatttattaagaaactgcaatttgatctag
A9JKY0_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
A9JLP1_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
D0Q0E8_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
D4I5M9_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
P42485_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
                        ************ *********************** ***

© 1998-2022Legal notice