Dataset for CDS adenoviridae of organism Simian mastadenovirus C

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

M9YVF6_E1B19K-01      atggatctcctaaggctgctcagcgattacgaggtgctgcgcaagttgct
M9YXY5_E1B19K-01      atggatctcctaaggttgctcagtgattacgaggtgctgcgcaagttgct
                      *************** ******* **************************

M9YVF6_E1B19K-01      ggagacagcctgtgagaaaaatcgcagctgttggaggtttttctttggct
M9YXY5_E1B19K-01      ggagacagcctgtgagaaaacttccagctgttggaggtttttctttggct
                      ******************** *  **************************

M9YVF6_E1B19K-01      ctactcttagcaacgtggtgcacagagtcaagcgagagcacagtgaagaa
M9YXY5_E1B19K-01      ctactcttagcaacgtggtgcacagagtcaagcgagagcacagtgaggaa
                      ********************************************** ***

M9YVF6_E1B19K-01      ttttctagactagtggcagatgttcccgggctttttgtttctttagattt
M9YXY5_E1B19K-01      ttttctagactagtggcagatgttcccgggctttttgtttctttagactt
                      *********************************************** **

M9YVF6_E1B19K-01      aggacatcactcttactttcaggagaagattgtcaagggtctagtgtttg
M9YXY5_E1B19K-01      aggacatcactcttactttcaggagaaaattgtaaagggtctagtgtttg
                      *************************** ***** ****************

M9YVF6_E1B19K-01      agtcaactggccgcacggttgtgtctgtggcttttatctgttttcttttg
M9YXY5_E1B19K-01      agtcaactggccgcacggttgtgtccgtggcttttatctgttttcttttg
                      ************************* ************************

M9YVF6_E1B19K-01      gataaatggagcagcgacagccacctgtcgtgggattacatgctggatta
M9YXY5_E1B19K-01      gataaatggagcagcgacagccacctgtcgtgggattacatgctggatta

M9YVF6_E1B19K-01      catgaccatggcgttgtggcgggcgctcctgaggaggaggagggcttgca
M9YXY5_E1B19K-01      catgaccatggcgctgtggcgggcgctcctgaggaggaggagggcttgca
                      ************* ************************************

M9YVF6_E1B19K-01      tttacttgccggtgcagcctcagcaaggtctggagcgagtggaggaagag
M9YXY5_E1B19K-01      tttacttgccggtgcagcctcagcgaggtctggagcgagtggaggaagag
                      ************************ *************************

M9YVF6_E1B19K-01      gaggag------gagaacccgagggcaggcgtggaccctcctctggaata
M9YXY5_E1B19K-01      gaggaggagaacgagaacccgagggccggcgtggaccctcctctggaata
                      ******      ************** ***********************

M9YVF6_E1B19K-01      g
M9YXY5_E1B19K-01      g

© 1998-2022Legal notice