Dataset for CDS E1B19K of organism Human mastadenovirus F

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6M6AEV2_E1B19K-      atggagttgtggagtgagttacaaagttatcagaacctccgacgcttgct
A0A6B9DS29_E1B19K-      atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
A0A6M6AES6_E1B19K-      atggagttttggagtgagctacaaagttatcagagcctccgacgcttgct
                        ******** ********* *************** ***************

A0A6M6AEV2_E1B19K-      ggagttggcttctgccagaacttccagctgttggagaatcctttttggct
A0A6B9DS29_E1B19K-      ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
A0A6M6AES6_E1B19K-      ggagttggcttctgccagaacttccagctgttggaggtttatttttggtt
                        ************************************  *  ******* *

A0A6M6AEV2_E1B19K-      caactttaactaatgtaatctatagagctaaggaggagtactcttcgcgg
A0A6B9DS29_E1B19K-      caaccttaactaatgtaatttatagagccaaagaggactactcttcgcga
A0A6M6AES6_E1B19K-      caaccttaactaatgtaatttatagagctaaagaggactactcttcgcga
                        **** ************** ******** ** ***** *********** 

A0A6M6AEV2_E1B19K-      tttgctgaccttttgtcgcataaccctggaatttttgcttctttgaattt
A0A6B9DS29_E1B19K-      tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
A0A6M6AES6_E1B19K-      tttgctgagcttttgtcttttaaccctggaatttttgcatctttaaattt
                        ******** ********   ****************** ***** *****

A0A6M6AEV2_E1B19K-      ggggcatcactcattttttcaagaaattgtaatcagaaatttagattttt
A0A6B9DS29_E1B19K-      gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
A0A6M6AES6_E1B19K-      gggccaccactcatttttccaggaaattgtgatcaaaaacttagattttt
                        *** ** *********** ** ******** **** *** **********

A0A6M6AEV2_E1B19K-      cttctcctggccgtacggtttctgggcttgcttttatttgttttatattg
A0A6B9DS29_E1B19K-      cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
A0A6M6AES6_E1B19K-      cttcccccggccgtacggtttctgggcttgctttcatttgttttatattg
                        **** ** ************************** ***************

A0A6M6AEV2_E1B19K-      gatcaatggagcgcccaaactcatctgtcgcagggttatactctggatta
A0A6B9DS29_E1B19K-      gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
A0A6M6AES6_E1B19K-      gatcaatggagcgcccaaacccatctgtcggaggggtatactctggatta
                        ******************** ********* **** **************

A0A6M6AEV2_E1B19K-      catggcaatggctctgtggagaaccttgctacggaggaagagggtcttag
A0A6B9DS29_E1B19K-      catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
A0A6M6AES6_E1B19K-      catgacaatggccctgtggagaaccctgctgcggaggaagagggtcttag
                        **** ******* ************ **** *******************

A0A6M6AEV2_E1B19K-      gttgcttgccggcgcagcgtccgcacggtttggatccagtgcaggaagag
A0A6B9DS29_E1B19K-      gttgctcgccggcgcagcctccgcacggtctggatccagtgcgggaggag
A0A6M6AES6_E1B19K-      gttgctcgccggcgcagcctccgcacggtctggatccagtgcg------g
                        ****** *********** ********** ************       *

A0A6M6AEV2_E1B19K-      gaggaggaggaggagaacctgagggccggcctggacccttcaacggaatt
A0A6B9DS29_E1B19K-      gaggaggaggaggagaacctgagggccggtctggatcctcaaacggaatt
A0A6M6AES6_E1B19K-      gaggaggaggaggagaacctgagggccggtctggatcctcaaacggaatt
                        ***************************** ***** ***  *********

A0A6M6AEV2_E1B19K-      gtaa
A0A6B9DS29_E1B19K-      gtaa
A0A6M6AES6_E1B19K-      gtaa
                        ****

© 1998-2021Legal notice