Dataset for CDS adenoviridae of organism Human mastadenovirus D

[Download (right click)] [Edit] [Sequences] [Repertoires]

52 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      atgactcatgggcggggcttagttctatataagtggcaacacctgggcac
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      atgactcatgggcggggcttagtcctatataagtggcaacacctgggcac
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        atgactcatgggcggggcttagtcctatataagtggcaacacctgggcac
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        --------------------------------------------------
T1UGY3_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
                                                                          

T1UG22_E1B19K-01        ----------------------------atggatgtgtggagtattcttg
T1UGY3_E1B19K-01        ----------------------------atggatgtgtggagtattcttg
T1UGU0_E1B19K-01        ----------------------------atggaggtgtggactatccttg
T1UK99_E1B19K-01        ----------------------------atggaggtgtggactatccttg
T1UKQ0_E1B19K-01        ----------------------------atggatgtgtggactatccttg
X4YVU5_E1B19K-01        ----------------------------atggaggtgtggactatccttg
A0A291B0H2_E1B19K-      ----------------------------atggatgtgtggactatccttg
T1UKV6_E1B19K-01        ----------------------------atggatgtgtggactatccttg
A0A097I4T0_E1B19K-      ----------------------------atggatgtgtggactatccttg
A0A3S6PYX7_E1B19K-      ttgggcacagaccttcagggagttcctgatggatgtgtggactatccttg
B6DU90_E1B19K-01        ----------------------------atggatgtgtggactatccttg
T1UHZ2_E1B19K-01        ----------------------------atggatgtgtggactatccttg
A0A0G2UY10_E1B19K-      ttgggcacagaccttcagggagttcctgatggatgtgtggactatccttg
A0A1J0MS84_E1B19K-      ----------------------------atggatgtgtggactatccttg
T1UKP8_E1B19K-01        ----------------------------atggatgtgtggactatccttg
T1UHQ8_E1B19K-01        ----------------------------atggatgtgtggactatccttg
A0A384ZUM9_E1B19K-      ----------------------------atggatgtgtggactatccttg
T1UHG3_E1B19K-01        ----------------------------atggatgtgtggactatccttg
A0A384ZUF2_E1B19K-      ----------------------------atggatgtgtggactatccttg
E1CIR1_E1B19K-01        ----------------------------atggatgtgtggactatccttg
X4Y9D2_E1B19K-01        tcgggcacagaccttcagggagttcctgatggatgtgtggactatccttg
T1UHH6_E1B19K-01        ----------------------------atggatgtgtggactatccttg
T1ULJ8_E1B19K-01        ----------------------------atggatgtgtggactatccttg
A0A075TSZ1_E1B19K-      ----------------------------atggatgtgtggactatccttg
T1ULP4_E1B19K-01        ----------------------------atggatgtgtggactatccttg
F8UFP5_E1B19K-01        ----------------------------atggaggtgtggactatccttg
T1UGT5_E1B19K-01        ----------------------------atggaggtgtggactatccttg
G3CK71_E1B19K-01        ----------------------------atggaggtgtggactatccttg
T1UGX3_E1B19K-01        ----------------------------atggatgtgtggactatccttg
T1UG22_E1B19K-02        --------------------------------------------------
T1UGY3_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
                                                                          

T1UG22_E1B19K-01        gggaatttaacaagacacgccggcttgtggaggatagttcagacgggtgc
T1UGY3_E1B19K-01        gggaatttaacaagacacgccggcttgtggaggatagttcagacgggtgc
T1UGU0_E1B19K-01        cggactttaacaagacacgccggcttgtggaggatagttcagacgggtgc
T1UK99_E1B19K-01        gggactttaacaagacacgccggcttgtggaggatagttcagacgggtgc
T1UKQ0_E1B19K-01        cggactttaacaagacacgccggcttgtagaggatagttcagacgggtgc
X4YVU5_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
A0A291B0H2_E1B19K-      gggactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
T1UKV6_E1B19K-01        gggattttaacaagacacgccggcttgtagaggatagttcagacgggtgc
A0A097I4T0_E1B19K-      cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
A0A3S6PYX7_E1B19K-      cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
B6DU90_E1B19K-01        cagactttagcaagacacgccgacttgtagaggatagttcagacgggtgc
T1UHZ2_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
A0A0G2UY10_E1B19K-      cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
A0A1J0MS84_E1B19K-      cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
T1UKP8_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
T1UHQ8_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
A0A384ZUM9_E1B19K-      cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
T1UHG3_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
A0A384ZUF2_E1B19K-      cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
E1CIR1_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
X4Y9D2_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
T1UHH6_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
T1ULJ8_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
A0A075TSZ1_E1B19K-      cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
T1ULP4_E1B19K-01        cagactttagcaagacacgccggcttgtagaggatagttcagacgggtgc
F8UFP5_E1B19K-01        cagactttaacaagacacgccggcttgtagaggatagttcagacgggtgc
T1UGT5_E1B19K-01        cagactttaacaagacacgccggcttgtagaggatagttcagacgggtgc
G3CK71_E1B19K-01        gagactttaacaagacacgccggcttgtagaggatagttcagacgggtgc
T1UGX3_E1B19K-01        cagactttagccagacacgccggcttgtagaggatagttcagacgggtgc
T1UG22_E1B19K-02        --------------------------------------------------
T1UGY3_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
                                                                          

T1UG22_E1B19K-01        tccgggttttggagacactggtttggaactcctctatctcgcctggtgta
T1UGY3_E1B19K-01        tccgggttttggagacactggtttggaactcctctatctcgcctggtgta
T1UGU0_E1B19K-01        tccggtttctggagacactggtttggaactcctctagctcgtctggtgta
T1UK99_E1B19K-01        tccggtttctggagacactggtttggaactcctctatctcgcctggtgta
T1UKQ0_E1B19K-01        tccggtttctggagacactggtttggatctcctctatctcgcctggtgta
X4YVU5_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
A0A291B0H2_E1B19K-      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1UKV6_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
A0A097I4T0_E1B19K-      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
A0A3S6PYX7_E1B19K-      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
B6DU90_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgtctggtgta
T1UHZ2_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgactggtgta
A0A0G2UY10_E1B19K-      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
A0A1J0MS84_E1B19K-      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1UKP8_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1UHQ8_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
A0A384ZUM9_E1B19K-      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1UHG3_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
A0A384ZUF2_E1B19K-      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
E1CIR1_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
X4Y9D2_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1UHH6_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1ULJ8_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
A0A075TSZ1_E1B19K-      tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1ULP4_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
F8UFP5_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1UGT5_E1B19K-01        tccggtttctggagacactggtttggaactcctctatctcgcctggtgta
G3CK71_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1UGX3_E1B19K-01        tccgggttctggagacactggtttggaactcctctatctcgcctggtgta
T1UG22_E1B19K-02        --------------------------------------------------
T1UGY3_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
                                                                          

T1UG22_E1B19K-01        cacagttaagaaggattatagcgaggaatttgaaaatctttttgccgact
T1UGY3_E1B19K-01        cacagttaaaaaggattatagcgaggaatttgaaaatctttttgccgact
T1UGU0_E1B19K-01        cacagttaagaaggattatcaggaggaatttgaaaatctttttgccgact
T1UK99_E1B19K-01        cactgttaagaaggattatcaggaggaatttgaaaatctttttgctgact
T1UKQ0_E1B19K-01        cactgttaagaaggattatcaggaggaatttgaaaatctttttgccgatt
X4YVU5_E1B19K-01        cacagttaagaaggattataacgaggaatttgaaaatctttttgtcgact
A0A291B0H2_E1B19K-      cacagttaagaaggattatagcgaggaatttgaaaatcttttttccgact
T1UKV6_E1B19K-01        cacagttaagaaggattatagcgaggaatttgaaaatcttttttccgact
A0A097I4T0_E1B19K-      cacagttaagaaggattataacgaggaatttgaaaatctttttgctgatt
A0A3S6PYX7_E1B19K-      cacagttaagaaggattataacgaggaatttgaaaatctttttgctgatt
B6DU90_E1B19K-01        cacagttaagaaggattataacgaggaatttgaaaatctttttgctgatt
T1UHZ2_E1B19K-01        cacagttaagaaggattataacgaggaatttgaaaatctttttgctgatt
A0A0G2UY10_E1B19K-      cacagttaagaaggattataacgaggaatttgaaaatctttttgctgact
A0A1J0MS84_E1B19K-      cacagttaagaaggattataacgaggaatttgaaaatctttttgctgact
T1UKP8_E1B19K-01        cacagttaagaaggattataacgaggaatttgaaaatctttttgctgact
T1UHQ8_E1B19K-01        cacagttaaaaaggattataacgaggaatttgaaaatctttttgctgatt
A0A384ZUM9_E1B19K-      cacagttaagaaggattataaagaggaatttgaaaatctttttgctgact
T1UHG3_E1B19K-01        cacagttaagaaggattataaagaggaatttgaaaatatttttgctgact
A0A384ZUF2_E1B19K-      cacagttaagaaggattataaagaggaatttgaaaatatttttgctgact
E1CIR1_E1B19K-01        cacagttaagaaggattataaagaggaatttgaaaatatttttgctgact
X4Y9D2_E1B19K-01        cacagttaagaaggattataacgaggaatttgaaaatctttttgctgact
T1UHH6_E1B19K-01        cacagttaagaaggattataaagaggaatttgaaaatatttttgctgact
T1ULJ8_E1B19K-01        cacagttaagaaggattataaagaggaatttgaaaatctttttgctgact
A0A075TSZ1_E1B19K-      cacagttaagaaggattataaagaggaatttgaaaatctttttgctgact
T1ULP4_E1B19K-01        cacagttaagaaggattataaagaggaatttgaaaatctttttgctgact
F8UFP5_E1B19K-01        cacagttaagaaggattatagcgaggaatttgaaaatcttttttccgact
T1UGT5_E1B19K-01        tacagttaagaaggattataacgaggaatttgaaaatctttttgccgact
G3CK71_E1B19K-01        cacagttaagaaggattataacgaggaatttgaaaatctttttgccgact
T1UGX3_E1B19K-01        cacagttaagaaggattataaagaggaatttgaaaatctttttgccgact
T1UG22_E1B19K-02        --------------------------------------------------
T1UGY3_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
                                                                          

T1UG22_E1B19K-01        gctctggcctgctagattctttaaattttggccaccagtcccttttccag
T1UGY3_E1B19K-01        gctctggcctgctagattctttaaattttggtcaccagtcccttttccag
T1UGU0_E1B19K-01        gttctggccttcttgattcactgaatcttggccaccaggctctattccag
T1UK99_E1B19K-01        gctctggcctgctagattctctgaatttcggccaccagtcccttttccag
T1UKQ0_E1B19K-01        gctctggcctgcttgattcactgaatctcggccaccaggctcttttccag
X4YVU5_E1B19K-01        gctctggcctgctagattctctgaatcttggccaccaggctctattccag
A0A291B0H2_E1B19K-      gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
T1UKV6_E1B19K-01        gctctggcctgctagattctctgaattttggccaccagtcccttttccag
A0A097I4T0_E1B19K-      gctctggcctactagattctctgaatctcggccaccagtcccttttccag
A0A3S6PYX7_E1B19K-      gctctggcctactagattctctgaatctcggccaccagtcccttttccag
B6DU90_E1B19K-01        gctctggcctgctagattctctgaatctcggccaccagtcccttttccag
T1UHZ2_E1B19K-01        gctctggcctgctagattctctgaatctcggccaccagtcccttttccag
A0A0G2UY10_E1B19K-      gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
A0A1J0MS84_E1B19K-      gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
T1UKP8_E1B19K-01        gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
T1UHQ8_E1B19K-01        gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
A0A384ZUM9_E1B19K-      gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
T1UHG3_E1B19K-01        gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
A0A384ZUF2_E1B19K-      gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
E1CIR1_E1B19K-01        gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
X4Y9D2_E1B19K-01        gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
T1UHH6_E1B19K-01        gctctggtctgctagattctctgaatcttggccaccagtcccttttccag
T1ULJ8_E1B19K-01        gctctggtctgctagattctctgaatcttggccaccaggctctattccag
A0A075TSZ1_E1B19K-      gctctggcctgctagattctctgaatcttggccaccagtcccttttccag
T1ULP4_E1B19K-01        gctctggtctgctagattctctgaatcttggccaccagtcccttttccag
F8UFP5_E1B19K-01        gctctggcctgcttgattcactgaattttggccaccagtcccttttccag
T1UGT5_E1B19K-01        gctctggcctgcttgattctctgaattttggccaccagtcccttttccag
G3CK71_E1B19K-01        gctctggcctgcttgattctttgaattttggccaccagtcccttttccag
T1UGX3_E1B19K-01        gctctggcctgcttgattctctgaattttggccaccagtcccttttccag
T1UG22_E1B19K-02        --------------------------------------------------
T1UGY3_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
                                                                          

T1UG22_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
T1UGY3_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
T1UGU0_E1B19K-01        gaaagggtcctccacagccttgatttttccagcccagggcgcactacagc
T1UK99_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
T1UKQ0_E1B19K-01        gaaagggtactccacagccttgatttttccagcccaggtcgcactacagc
X4YVU5_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
A0A291B0H2_E1B19K-      gaaagggtactccacagccttgatttttcatctcccgggcgcactacagc
T1UKV6_E1B19K-01        gaaagggtccttcacagccttgatttttcatctcccggacgcactacagc
A0A097I4T0_E1B19K-      gaaagggtactccacagccttgatttttccagtccagggcgcactacagc
A0A3S6PYX7_E1B19K-      gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
B6DU90_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
T1UHZ2_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
A0A0G2UY10_E1B19K-      gaaagggtactccacagtcttgatttttccagcccagggcgcactacagc
A0A1J0MS84_E1B19K-      gaaagggtactccacagtcttgatttttccagcccagggcgcactacagc
T1UKP8_E1B19K-01        gaaagggtacttcacagccttgatttttccagcccagggcgcactacagc
T1UHQ8_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
A0A384ZUM9_E1B19K-      gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
T1UHG3_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
A0A384ZUF2_E1B19K-      gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
E1CIR1_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
X4Y9D2_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
T1UHH6_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
T1ULJ8_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
A0A075TSZ1_E1B19K-      gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
T1ULP4_E1B19K-01        gaaagggtactccacagccttgatttttccagcccagggcgcactacagc
F8UFP5_E1B19K-01        gaaagggtcctccacagccttgatttttccagcccagggcgcactacagc
T1UGT5_E1B19K-01        gaaagggtcctccacagccttgatttttccagcccagggcgcactacagc
G3CK71_E1B19K-01        gaaagggtcctccacagccttgatttttccagcccagggcgcactacagc
T1UGX3_E1B19K-01        gaaagggtcctccacagccttgatttttccagcccagggcgcactacagc
T1UG22_E1B19K-02        --------------------------------------------------
T1UGY3_E1B19K-02        --------------------------------------------------
T1UGU0_E1B19K-02        --------------------------------------------------
T1UKQ0_E1B19K-02        --------------------------------------------------
T1UK99_E1B19K-02        --------------------------------------------------
T1UKP8_E1B19K-02        --------------------------------------------------
T1ULJ8_E1B19K-02        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
F8UFP5_E1B19K-02        --------------------------------------------------
T1UGT5_E1B19K-02        --------------------------------------------------
T1UHZ2_E1B19K-02        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-02        --------------------------------------------------
T1UHQ8_E1B19K-02        --------------------------------------------------
T1UGX3_E1B19K-02        --------------------------------------------------
T1ULP4_E1B19K-02        --------------------------------------------------
G3CK71_E1B19K-02        --------------------------------------------------
T1UHH6_E1B19K-02        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-02        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
                                                                          

T1UG22_E1B19K-01        cggggttgcttttgtggtttttttggttgacaaatggagccaggacaccc
T1UGY3_E1B19K-01        cggggttgcttttgtggtttttttggttgacaaatggagccaggacaccc
T1UGU0_E1B19K-01        cggtgttgcttttgtggtgtttctggttgacaaatggagccagcaaaccc
T1UK99_E1B19K-01        cggtgttgcatttgtggtgtttctggttgacaaatggagccagcaaaccc
T1UKQ0_E1B19K-01        cggtgttgcatttgtggtgtttctggttgacaaatggagccagcaaaccc
X4YVU5_E1B19K-01        cggggttgcgtttgtggtgtttctggttgacaaatggagccagcaaaccc
A0A291B0H2_E1B19K-      cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
T1UKV6_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
A0A097I4T0_E1B19K-      cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
A0A3S6PYX7_E1B19K-      cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
B6DU90_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
T1UHZ2_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
A0A0G2UY10_E1B19K-      cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
A0A1J0MS84_E1B19K-      cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
T1UKP8_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
T1UHQ8_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
A0A384ZUM9_E1B19K-      cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
T1UHG3_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
A0A384ZUF2_E1B19K-      cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
E1CIR1_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
X4Y9D2_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggcgccaggacaccc
T1UHH6_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
T1ULJ8_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
A0A075TSZ1_E1B19K-      cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
T1ULP4_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccaggacaccc
F8UFP5_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
T1UGT5_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
G3CK71_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
T1UGX3_E1B19K-01        cggggttgcttttgtggtttttctggttgacaaatggagccagaacaccc
T1UG22_E1B19K-02        ---------------------------------atggagccaggacaccc
T1UGY3_E1B19K-02        ---------------------------------atggagccaggacaccc
T1UGU0_E1B19K-02        ---------------------------------atggagccagcaaaccc
T1UKQ0_E1B19K-02        ---------------------------------atggagccagcaaaccc
T1UK99_E1B19K-02        ---------------------------------atggagccagcaaaccc
T1UKP8_E1B19K-02        ---------------------------------atggagccaggacaccc
T1ULJ8_E1B19K-02        ---------------------------------atggagccaggacaccc
A0A384ZUM9_E1B19K-      ---------------------------------atggagccaggacaccc
F8UFP5_E1B19K-02        ---------------------------------atggagccagaacaccc
T1UGT5_E1B19K-02        ---------------------------------atggagccagaacaccc
T1UHZ2_E1B19K-02        ---------------------------------atggagccagaacaccc
A0A097I4T0_E1B19K-      ---------------------------------atggagccagaacaccc
A0A3S6PYX7_E1B19K-      ---------------------------------atggagccagaacaccc
T1UKV6_E1B19K-02        ---------------------------------atggagccaggacaccc
T1UHQ8_E1B19K-02        ---------------------------------atggagccaggacaccc
T1UGX3_E1B19K-02        ---------------------------------atggagccagaacaccc
T1ULP4_E1B19K-02        ---------------------------------atggagccaggacaccc
G3CK71_E1B19K-02        ---------------------------------atggagccagaacaccc
T1UHH6_E1B19K-02        ---------------------------------atggagccaggacaccc
A0A0G2UY10_E1B19K-      ---------------------------------atggagccagaacaccc
A0A384ZUF2_E1B19K-      ---------------------------------atggagccaggacaccc
T1UHG3_E1B19K-02        ---------------------------------atggagccaggacaccc
A0A075TSZ1_E1B19K-      ---------------------------------atggagccaggacaccc
                                                         **** ***** * ****

T1UG22_E1B19K-01        aactaagcaggggctacattctggactttgcagccatgcacctgtggagg
T1UGY3_E1B19K-01        aactaagcaggggctacattctggactttgcagccatgcacctgtggagg
T1UGU0_E1B19K-01        acctaaccagggattacatcctggacttcacggccatgcatctgtggaag
T1UK99_E1B19K-01        acttaaccagggattacatcctggacttcacggccatgcacctgtggaag
T1UKQ0_E1B19K-01        acttaaccagggattacatcctggacttcacggccatgcacctgtggaag
X4YVU5_E1B19K-01        atctgaccagggattacatcctggacttcacggccatgcatctgtggaag
A0A291B0H2_E1B19K-      aactgagcaggggatacatcctggacttcgcagccatgcatctgtggagg
T1UKV6_E1B19K-01        aactgagcaggggctacatcctggacttcgcagccatgcatctgtggagg
A0A097I4T0_E1B19K-      aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
A0A3S6PYX7_E1B19K-      aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
B6DU90_E1B19K-01        aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
T1UHZ2_E1B19K-01        aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
A0A0G2UY10_E1B19K-      aactgagcaggggctacattctggacttcgcggccatgcacctgtggagg
A0A1J0MS84_E1B19K-      aactgagcaggggctacatcctggacttcgcggccatgcacctgtggagg
T1UKP8_E1B19K-01        aactgagcaggggatacatcctggacttcgcagccatgcacctgtggagg
T1UHQ8_E1B19K-01        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
A0A384ZUM9_E1B19K-      aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
T1UHG3_E1B19K-01        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
A0A384ZUF2_E1B19K-      aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
E1CIR1_E1B19K-01        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
X4Y9D2_E1B19K-01        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
T1UHH6_E1B19K-01        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
T1ULJ8_E1B19K-01        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
A0A075TSZ1_E1B19K-      aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
T1ULP4_E1B19K-01        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
F8UFP5_E1B19K-01        aactgagcaggggctacatcctggacttcgcggccatgcacctgtggagg
T1UGT5_E1B19K-01        aactgagcaggggctacatcctggacttcgcggccatgcacctgtggagg
G3CK71_E1B19K-01        aactgagcaggggctacattctggacttcgcggccatgcacctgtggagg
T1UGX3_E1B19K-01        aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
T1UG22_E1B19K-02        aactaagcaggggctacattctggactttgcagccatgcacctgtggagg
T1UGY3_E1B19K-02        aactaagcaggggctacattctggactttgcagccatgcacctgtggagg
T1UGU0_E1B19K-02        acctaaccagggattacatcctggacttcacggccatgcatctgtggaag
T1UKQ0_E1B19K-02        acttaaccagggattacatcctggacttcacggccatgcacctgtggaag
T1UK99_E1B19K-02        acttaaccagggattacatcctggacttcacggccatgcacctgtggaag
T1UKP8_E1B19K-02        aactgagcaggggatacatcctggacttcgcagccatgcacctgtggagg
T1ULJ8_E1B19K-02        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
A0A384ZUM9_E1B19K-      aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
F8UFP5_E1B19K-02        aactgagcaggggctacatcctggacttcgcggccatgcacctgtggagg
T1UGT5_E1B19K-02        aactgagcaggggctacatcctggacttcgcggccatgcacctgtggagg
T1UHZ2_E1B19K-02        aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
A0A097I4T0_E1B19K-      aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
A0A3S6PYX7_E1B19K-      aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
T1UKV6_E1B19K-02        aactgagcaggggctacatcctggacttcgcagccatgcatctgtggagg
T1UHQ8_E1B19K-02        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
T1UGX3_E1B19K-02        aactgagcaggggctacattctggacttcgcagccatgcacctgtggagg
T1ULP4_E1B19K-02        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
G3CK71_E1B19K-02        aactgagcaggggctacattctggacttcgcggccatgcacctgtggagg
T1UHH6_E1B19K-02        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
A0A0G2UY10_E1B19K-      aactgagcaggggctacattctggacttcgcggccatgcacctgtggagg
A0A384ZUF2_E1B19K-      aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
T1UHG3_E1B19K-02        aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
A0A075TSZ1_E1B19K-      aactgagcaggggctacatcctggacttcgcagccatgcacctgtggagg
                        *  * * *****  ***** ********  * ******** ******* *

T1UG22_E1B19K-01        gcctggatgaggcagcggggacagagaatcttgaactactggcttctaca
T1UGY3_E1B19K-01        gcctggatgaggcagcggggacagagaatcttgaactactggcttctaca
T1UGU0_E1B19K-01        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UK99_E1B19K-01        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UKQ0_E1B19K-01        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
X4YVU5_E1B19K-01        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
A0A291B0H2_E1B19K-      gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1UKV6_E1B19K-01        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
A0A097I4T0_E1B19K-      gcatgggtcaggcagcggggacagagaatcttgaactactggcttataca
A0A3S6PYX7_E1B19K-      gcatgggtcaggcagcggggacagagaatcttgaactactggcttataca
B6DU90_E1B19K-01        gcatgggtgaggcagcggggacagagaatcttgaactactggcttataca
T1UHZ2_E1B19K-01        gcatgggtgaggcagcggggacagagaatcttgaactactggcttataca
A0A0G2UY10_E1B19K-      tcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
A0A1J0MS84_E1B19K-      tcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UKP8_E1B19K-01        tcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1UHQ8_E1B19K-01        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
A0A384ZUM9_E1B19K-      gcctggatcaggcagcggggacagagaatcttgagttactggcttctaca
T1UHG3_E1B19K-01        gcctggatcaggcagcggggacagagaatcttgaattactggcttctaca
A0A384ZUF2_E1B19K-      gcctggatcaggcagcggggacagagaatcttgaattactggcttctaca
E1CIR1_E1B19K-01        gcctggatcaggcagcggggacagagaatcttgaattactggcttctaca
X4Y9D2_E1B19K-01        tcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1UHH6_E1B19K-01        tcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1ULJ8_E1B19K-01        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
A0A075TSZ1_E1B19K-      tcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1ULP4_E1B19K-01        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
F8UFP5_E1B19K-01        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1UGT5_E1B19K-01        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
G3CK71_E1B19K-01        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UGX3_E1B19K-01        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UG22_E1B19K-02        gcctggatgaggcagcggggacagagaatcttgaactactggcttctaca
T1UGY3_E1B19K-02        gcctggatgaggcagcggggacagagaatcttgaactactggcttctaca
T1UGU0_E1B19K-02        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UKQ0_E1B19K-02        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UK99_E1B19K-02        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UKP8_E1B19K-02        tcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1ULJ8_E1B19K-02        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
A0A384ZUM9_E1B19K-      gcctggatcaggcagcggggacagagaatcttgagttactggcttctaca
F8UFP5_E1B19K-02        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1UGT5_E1B19K-02        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UHZ2_E1B19K-02        gcatgggtgaggcagcggggacagagaatcttgaactactggcttataca
A0A097I4T0_E1B19K-      gcatgggtcaggcagcggggacagagaatcttgaactactggcttataca
A0A3S6PYX7_E1B19K-      gcatgggtcaggcagcggggacagagaatcttgaactactggcttataca
T1UKV6_E1B19K-02        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1UHQ8_E1B19K-02        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
T1UGX3_E1B19K-02        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1ULP4_E1B19K-02        gcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
G3CK71_E1B19K-02        gcctgggtcaggcagcggggacagagaatcttgaactactggcttctaca
T1UHH6_E1B19K-02        tcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
A0A0G2UY10_E1B19K-      tcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
A0A384ZUF2_E1B19K-      gcctggatcaggcagcggggacagagaatcttgaattactggcttctaca
T1UHG3_E1B19K-02        gcctggatcaggcagcggggacagagaatcttgaattactggcttctaca
A0A075TSZ1_E1B19K-      tcctggatcaggcagcggggacagagaatcttgaactactggcttctaca
                         * *** * *************************  ********* ****

T1UG22_E1B19K-01        gccagcagcttcgggtcttcttcatctacacagacaaacatccatgttgg
T1UGY3_E1B19K-01        gccagcagcttcgggtcttcttcatctacacagacaaacatccatgttgg
T1UGU0_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UK99_E1B19K-01        gccagcagctccgggtcttcttcatctacacagacaaacatccatgttgg
T1UKQ0_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
X4YVU5_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A291B0H2_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UKV6_E1B19K-01        gccagcagttccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A097I4T0_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A3S6PYX7_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
B6DU90_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UHZ2_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A0G2UY10_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A1J0MS84_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UKP8_E1B19K-01        gccagcagctccaggtcttcttcgtctacacagacaaacatccatgttgg
T1UHQ8_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A384ZUM9_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UHG3_E1B19K-01        gccagcagctccgggtcttctttgtctacacagacaaacatccatgttgg
A0A384ZUF2_E1B19K-      gccagcagctccggttcttcttcgtctacacagacaaacatccatgttgg
E1CIR1_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
X4Y9D2_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UHH6_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1ULJ8_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A075TSZ1_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1ULP4_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
F8UFP5_E1B19K-01        gccagcagctccgggtcttcttcatctacacagacaaacatccatgttgg
T1UGT5_E1B19K-01        gccagcagttccgggtcttcttcgtctacacagacaaacatccatgttgg
G3CK71_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UGX3_E1B19K-01        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UG22_E1B19K-02        gccagcagcttcgggtcttcttcatctacacagacaaacatccatgttgg
T1UGY3_E1B19K-02        gccagcagcttcgggtcttcttcatctacacagacaaacatccatgttgg
T1UGU0_E1B19K-02        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UKQ0_E1B19K-02        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UK99_E1B19K-02        gccagcagctccgggtcttcttcatctacacagacaaacatccatgttgg
T1UKP8_E1B19K-02        gccagcagctccaggtcttcttcgtctacacagacaaacatccatgttgg
T1ULJ8_E1B19K-02        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A384ZUM9_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
F8UFP5_E1B19K-02        gccagcagctccgggtcttcttcatctacacagacaaacatccatgttgg
T1UGT5_E1B19K-02        gccagcagttccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UHZ2_E1B19K-02        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A097I4T0_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A3S6PYX7_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UKV6_E1B19K-02        gccagcagttccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UHQ8_E1B19K-02        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UGX3_E1B19K-02        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1ULP4_E1B19K-02        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
G3CK71_E1B19K-02        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
T1UHH6_E1B19K-02        gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A0G2UY10_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
A0A384ZUF2_E1B19K-      gccagcagctccggttcttcttcgtctacacagacaaacatccatgttgg
T1UHG3_E1B19K-02        gccagcagctccgggtcttctttgtctacacagacaaacatccatgttgg
A0A075TSZ1_E1B19K-      gccagcagctccgggtcttcttcgtctacacagacaaacatccatgttgg
                        ******** * * * *******  **************************

T1UG22_E1B19K-01        aggaagaaatgagggaggccatggacaagaacccgaggagcggcctggac
T1UGY3_E1B19K-01        aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
T1UGU0_E1B19K-01        aggaagagatgagggaggccatggacgagaacccgaggagcggcctggac
T1UK99_E1B19K-01        aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
T1UKQ0_E1B19K-01        aggaagagatgagggaggccatggacgagaacccgaggagcggcctggac
X4YVU5_E1B19K-01        aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
A0A291B0H2_E1B19K-      aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
T1UKV6_E1B19K-01        aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
A0A097I4T0_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A3S6PYX7_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
B6DU90_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1UHZ2_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A0G2UY10_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A1J0MS84_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1UKP8_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1UHQ8_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A384ZUM9_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1UHG3_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A384ZUF2_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
E1CIR1_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
X4Y9D2_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1UHH6_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1ULJ8_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A075TSZ1_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1ULP4_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
F8UFP5_E1B19K-01        aggaagaaatgagggaggccatggacgacaacccgaggagcggcctggac
T1UGT5_E1B19K-01        aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
G3CK71_E1B19K-01        aggaagaaatgaggcaggccatgtacgagaacccgaggagcggcctggac
T1UGX3_E1B19K-01        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1UG22_E1B19K-02        aggaagaaatgagggaggccatggacaagaacccgaggagcggcctggac
T1UGY3_E1B19K-02        aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
T1UGU0_E1B19K-02        aggaagagatgagggaggccatggacgagaacccgaggagcggcctggac
T1UKQ0_E1B19K-02        aggaagagatgagggaggccatggacgagaacccgaggagcggcctggac
T1UK99_E1B19K-02        aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
T1UKP8_E1B19K-02        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1ULJ8_E1B19K-02        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A384ZUM9_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
F8UFP5_E1B19K-02        aggaagaaatgagggaggccatggacgacaacccgaggagcggcctggac
T1UGT5_E1B19K-02        aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
T1UHZ2_E1B19K-02        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A097I4T0_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A3S6PYX7_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1UKV6_E1B19K-02        aggaagaaatgagggaggccatggacgagaacccgaggagcggcctggac
T1UHQ8_E1B19K-02        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1UGX3_E1B19K-02        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1ULP4_E1B19K-02        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
G3CK71_E1B19K-02        aggaagaaatgaggcaggccatgtacgagaacccgaggagcggcctggac
T1UHH6_E1B19K-02        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A0G2UY10_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A384ZUF2_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
T1UHG3_E1B19K-02        aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
A0A075TSZ1_E1B19K-      aggaagaaatgaggcaggccatggacgagaacccgaggagcggcctggac
                        ******* ****** ******** ** * *********************

T1UG22_E1B19K-01        cctccgtcggaagaggagctggattaa-----------------------
T1UGY3_E1B19K-01        cctccgtcggaagaggagctggattaa-----------------------
T1UGU0_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
T1UK99_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
T1UKQ0_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
X4YVU5_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
A0A291B0H2_E1B19K-      cctccgtcggaagaggagctggattga-----------------------
T1UKV6_E1B19K-01        cctccgtcggaagaggagttggattga-----------------------
A0A097I4T0_E1B19K-      cctccgccggaagaggagctggattga-----------------------
A0A3S6PYX7_E1B19K-      cctccgtcggaagaggagctggattga-----------------------
B6DU90_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
T1UHZ2_E1B19K-01        cctccgtcggaagaggagctgaattga-----------------------
A0A0G2UY10_E1B19K-      cctccgtcggaagaggagctggattga-----------------------
A0A1J0MS84_E1B19K-      cctccgtcggaagaggagctggattga-----------------------
T1UKP8_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
T1UHQ8_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
A0A384ZUM9_E1B19K-      cctccgtcggaagaggagctggattga-----------------------
T1UHG3_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
A0A384ZUF2_E1B19K-      cctccgtcggaagaggagctggattga-----------------------
E1CIR1_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
X4Y9D2_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
T1UHH6_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
T1ULJ8_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
A0A075TSZ1_E1B19K-      cctccgtcggaagaggagctggattga-----------------------
T1ULP4_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
F8UFP5_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
T1UGT5_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
G3CK71_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
T1UGX3_E1B19K-01        cctccgtcggaagaggagctggattga-----------------------
T1UG22_E1B19K-02        cctccgtcggaagaggagctggattaaatgaggtatccagcctataccca
T1UGY3_E1B19K-02        cctccgtcggaagaggagctggattaaatgaggtatccagcctgtaccca
T1UGU0_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
T1UKQ0_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
T1UK99_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
T1UKP8_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
T1ULJ8_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
A0A384ZUM9_E1B19K-      cctccgtcggaagaggagctggattgaatcaggtagccagcctgtaccca
F8UFP5_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
T1UGT5_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
T1UHZ2_E1B19K-02        cctccgtcggaagaggagctgaattgaatcaggtatccagcttgtaccca
A0A097I4T0_E1B19K-      cctccgccggaagaggagctggattgaatcaggtatccagcttgtaccca
A0A3S6PYX7_E1B19K-      cctccgtcggaagaggagctggattgaatcaggtatccagcttgtaccca
T1UKV6_E1B19K-02        cctccgtcggaagaggagttggattgaatcaggtatccagcctgtaccct
T1UHQ8_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtagccagcctgtaccca
T1UGX3_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
T1ULP4_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtatcca
G3CK71_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
T1UHH6_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
A0A0G2UY10_E1B19K-      cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
A0A384ZUF2_E1B19K-      cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
T1UHG3_E1B19K-02        cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
A0A075TSZ1_E1B19K-      cctccgtcggaagaggagctggattgaatcaggtatccagcctgtaccca
                        ****** *********** ** *** *                       

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
T1UGY3_E1B19K-02        gagcttagcaaggtgctgacatccatggccaggggagtaaagagggagag
T1UGU0_E1B19K-02        gagcttagcaaggtgctgacaaccatggccaggggagtgaagagggagag
T1UKQ0_E1B19K-02        gagcttagcaaggtgttgacaaccatggccaggggagtgaagagggagag
T1UK99_E1B19K-02        gagcttagcaaggtgctgacaaccatggccaggggagtgaagagggagag
T1UKP8_E1B19K-02        gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
T1ULJ8_E1B19K-02        gagcttagcaaggtgctgacaaccatggccaggggagtgaagagggagag
A0A384ZUM9_E1B19K-      gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
F8UFP5_E1B19K-02        gagcttagcagggtgctgacatccatggccaggggagtgaagcgggagag
T1UGT5_E1B19K-02        gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
T1UHZ2_E1B19K-02        gagcttagcaaggtgctgacatccatggctaggggagtgaagagggagag
A0A097I4T0_E1B19K-      gagcttagcaaggtgctgacatccatggcaaggggagtgaagagggagag
A0A3S6PYX7_E1B19K-      gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
T1UKV6_E1B19K-02        gagcttagcagggtgctgacatccatggccaggggagtgaagagggagag
T1UHQ8_E1B19K-02        gagcttagcaaggtgctgacaaccatggccaggggagtgaagagggagag
T1UGX3_E1B19K-02        gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
T1ULP4_E1B19K-02        gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
G3CK71_E1B19K-02        gagcttagcagggtgctgacatccatggccaggggagtgaagagggagag
T1UHH6_E1B19K-02        gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
A0A0G2UY10_E1B19K-      gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
A0A384ZUF2_E1B19K-      gagcttagcaaggtgctgacatccatggccaggggagttaagagggagag
T1UHG3_E1B19K-02        gagcttagcaaggtgctgacatccatggccaggggagttaagagggagag
A0A075TSZ1_E1B19K-      gagcttagcaaggtgctgacatccatggccaggggagtgaagagggagag
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        gagcgatgggggcaatactgggctgatgacccagctaactgccagcctaa
T1UGY3_E1B19K-02        gagcgatgggggcaataccgggctgatgaccgagctaactgccagcctga
T1UGU0_E1B19K-02        gagcgatgggggcaatactgggatgatgaccgagctgacagccagcctga
T1UKQ0_E1B19K-02        gagcgatgggggcaataccgggatgatgaccgagctgacagccagcctga
T1UK99_E1B19K-02        gagcgatgggggcaataccgggatgatgaccgagctgacggccagcctga
T1UKP8_E1B19K-02        gagtgatgggggcaataccgggatgatgaccgagctgacggccagcttga
T1ULJ8_E1B19K-02        gagtgatgggggcaataccgggatgatgaccgagctgactgccagcctca
A0A384ZUM9_E1B19K-      gagcgatgggggcaataccgggatgatgaccgagttgacggccagcctga
F8UFP5_E1B19K-02        gagcgatgggggcaataccgggatgatgaccgagctgacggccagcctga
T1UGT5_E1B19K-02        gagcgatgggggcaataccgggatgatgaccgagctgacggccagcctga
T1UHZ2_E1B19K-02        gagcgatgggggcaataccgggatgatgaccgagctgacggccagcctga
A0A097I4T0_E1B19K-      gagcgatgggggtaataccgggatgatgaccgagctaacggccagcctga
A0A3S6PYX7_E1B19K-      gagcgatgggggcaataccgggatgatgaccgagctgacggccagcctga
T1UKV6_E1B19K-02        gagcgatgggggcaataccgggatgatgaccgagctgacggccagcctga
T1UHQ8_E1B19K-02        gagtgatgggggcaataccgggatgatgaccgagctgactgccagcctga
T1UGX3_E1B19K-02        gagcgatgggggcaataccgggatgatgacagagctgacggccagcctga
T1ULP4_E1B19K-02        gagcgatgggggcaataccgggatgatgaccgagctaactgccagcctga
G3CK71_E1B19K-02        gagcgatgggggcaataccgggatgatgacagagctgacggccagtctga
T1UHH6_E1B19K-02        gagcgatgggggcaataccgggatgatgaccgagctgactgccagtctga
A0A0G2UY10_E1B19K-      gagcgatgggggcaataccgggatgatgaccgagctgacggccagcctga
A0A384ZUF2_E1B19K-      gagcgatgggggtaataccgggatgatgaccgagctgacggccagcctga
T1UHG3_E1B19K-02        gagcgatgggggtaataccgggatgatgaccgagctgacggccagcctga
A0A075TSZ1_E1B19K-      gagcgatgggggcaataccgggatgatgaccgagctgacggccagcctga
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        tgaatcgcaagcgcccagagcgtattacctggcacgagctacagcaggag
T1UGY3_E1B19K-02        tgaatcgcaagcgcccagagcgtattacctggcacgagctacagcaggag
T1UGU0_E1B19K-02        tgaatcgcaggcgacctgagcgcattacctggcatgagctacagcaggag
T1UKQ0_E1B19K-02        tgaatcgcaggcgacctgagcgcattacctggcacgagctacagcaggag
T1UK99_E1B19K-02        tgaatcgcaagcgcccagagcgcattacctggcacgagctacagcaggag
T1UKP8_E1B19K-02        tgaatcgcaagcgtccagagcgcattacctggcacgagctacagcaggag
T1ULJ8_E1B19K-02        tgaatcggaagcgcccagagcgcattacctggcacgagctacagcaggag
A0A384ZUM9_E1B19K-      tgaatcgtaagcgcccagagcgcattacctggcacgagctacagcaggag
F8UFP5_E1B19K-02        tgaatcgcaagcgcccagagcgcattacctggcatgagctacagctggag
T1UGT5_E1B19K-02        tgaatcgcaagcgcccagagcgcatcacctggcatgagctacagctggag
T1UHZ2_E1B19K-02        tgaatcgcaagcgcccagagcgcattacctggcacgagctacagatggag
A0A097I4T0_E1B19K-      tgaatcgcaagcgcccagagcgcattacctggcacgagctacagatggag
A0A3S6PYX7_E1B19K-      tgaatcgcaagcgcccagagcgcattacctggcacgagctacagatggag
T1UKV6_E1B19K-02        tgaatcgcaagcgcccagagcgcattacctggcacgagctacagattgag
T1UHQ8_E1B19K-02        tgaatcgcaagcgcccagagcgcattacctggcacgagctacagcaggag
T1UGX3_E1B19K-02        tgaatcgcaagcgcccagagcgcattacctggcatgagctacagatggag
T1ULP4_E1B19K-02        tgaatcgcaagcgcccagagcgccttacctggtacgagctacagcaggag
G3CK71_E1B19K-02        tgaatcgcaagcgcccagagcgcattacctggcacgagctacagcaggag
T1UHH6_E1B19K-02        tgaatcggaagcgcccagagcgccttacctggtacgagctacagcaagag
A0A0G2UY10_E1B19K-      tgaatcgcaagcgcccagaacgcattacctggcacgagctacagatggag
A0A384ZUF2_E1B19K-      tgaatcggaagcgcccagagcgccttacctggtacgagctacagcaggag
T1UHG3_E1B19K-02        tgaatcggaagcgcccagagcgccttacctggtacgagctacagcaggag
A0A075TSZ1_E1B19K-      tgaatcgcaagcgtccagagcgcattacctggcacgagctacagatggag
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatggcctggagcaaat
T1UGY3_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatggcctggagcaaat
T1UGU0_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatggcctggagcagat
T1UKQ0_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatggcctggagcagat
T1UK99_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatggcctggagcagat
T1UKP8_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatggcctggagcagat
T1ULJ8_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatgggctggagcagat
A0A384ZUM9_E1B19K-      tgcagggatgagataggcttgatgcaggataaatatggcctggagcagat
F8UFP5_E1B19K-02        tgcagggatgaggtcggcctgatgcaggataaatatggcctggagcagat
T1UGT5_E1B19K-02        tgcagggatgaggtgggcctgatgcaggataaatatggcctggagcagat
T1UHZ2_E1B19K-02        tgcagggatgagttgggcctgatgcaggataaatatggcctggagcagat
A0A097I4T0_E1B19K-      tgcagggatgagttgggcctgatgcaggataaatatggcctggagcagat
A0A3S6PYX7_E1B19K-      tgcagggatgagttgggcctgatgcaggataaatatggcctggagcagat
T1UKV6_E1B19K-02        tgcagggatgaggtgggcctgatgcaggataaatacggcctggagcagat
T1UHQ8_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatgggctggagcagat
T1UGX3_E1B19K-02        tgcagggatgaggtgggcctgatgcaggataaatatggcctggagcagat
T1ULP4_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatggtctggagcagat
G3CK71_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatggcctggagcagat
T1UHH6_E1B19K-02        tgcagggatgagataggcctgatgcaggataaatatgggctggagcagat
A0A0G2UY10_E1B19K-      tgcagggatgaggtgggcctgatgcaggataaatatggcctggagcagat
A0A384ZUF2_E1B19K-      tgcagggatgagttgggcctgatgcaggataaatatggcctggagcagat
T1UHG3_E1B19K-02        tgcagggatgagttgggcctgatgcaggataaatatggcctggagcagat
A0A075TSZ1_E1B19K-      tgcagggatgaggtgggcctgatgcaggataaatatggcctggagcagat
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        aaaaacccattggttgaacccagacgaggattgggaggaggccattaaga
T1UGY3_E1B19K-02        aaaaacccattggttgaacccagacgaggattgggaggaggccattaaga
T1UGU0_E1B19K-02        aaaaacccactggttgaacccagatgaggattgggaggaggccattaaga
T1UKQ0_E1B19K-02        aaaaacccactggttaaacccagatgaggattgggaggaggccattaaga
T1UK99_E1B19K-02        aaaaacccactggttgaacccagatgaggattgggaggaggccattaaga
T1UKP8_E1B19K-02        aaaaacccactggttgaacccagatgaggattgggaggaggccattaaga
T1ULJ8_E1B19K-02        aaaaactcactggttgaacccagatgaggattgggaggaggccataaaga
A0A384ZUM9_E1B19K-      aaaaacccattggttgaacccagatgaggattgggaggaggccattaaga
F8UFP5_E1B19K-02        aaaaacccactggttgaacccagatgaggattgggaggaggccattaaga
T1UGT5_E1B19K-02        aaaaacccattggttgaacccagatgaggattgggaggaggccattaaaa
T1UHZ2_E1B19K-02        aaaaacacattggttgaacccagatgaggattgggaggaggccattaaga
A0A097I4T0_E1B19K-      aaaaacacattggttgaacccagatgaggattgggaggaggccattaaga
A0A3S6PYX7_E1B19K-      aaaaacacattggttgaacccagatgaggattgggaggaggccattaaga
T1UKV6_E1B19K-02        aaaaacccactggttgaacccagatgaggattgggaggaggccattaaga
T1UHQ8_E1B19K-02        aaaaactcactggttgaacccagatgaggattgggaggaggccataaaga
T1UGX3_E1B19K-02        aaaaacccactggttgaacccagatgaggattgggaggaggccattaaga
T1ULP4_E1B19K-02        aaaaacccattggttgaacccagatgaggattgggaggaggccattaaga
G3CK71_E1B19K-02        aaaaacccactggttgaacccagatgaggattgggaggaggccattaaga
T1UHH6_E1B19K-02        aaaaactcactggttgaacccagatgaggattgggaggaggccattaaga
A0A0G2UY10_E1B19K-      aaaaacccactggttgaacccagatgaggattgggaggaagccattaaga
A0A384ZUF2_E1B19K-      aaaaacccattggttgaacccagatgaggattgggaggaggctattaaga
T1UHG3_E1B19K-02        aaaaacccattggttgaacccagatgaggattgggaggaggctattaaga
A0A075TSZ1_E1B19K-      aaaaacccattggttgaacccagatgaggattgggaggaggccattaaga
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacagggtgactaag
T1UGY3_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacagggtgactaag
T1UGU0_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacagggtgaccaag
T1UKQ0_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacagggtgaccaag
T1UK99_E1B19K-02        agtatgccaagatagccctgcgtccagattgcaagtacaggattaccaag
T1UKP8_E1B19K-02        agtatgccaagatagccctgcgcccagattgcaagtacaggatcaccaag
T1ULJ8_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacaaaatcaccaag
A0A384ZUM9_E1B19K-      agtatgccaagatagccctgcgcccagattgcaagtacatagtgaccaag
F8UFP5_E1B19K-02        agtatgccaagattgccctgcgcccagattgcaagtacagggtgaccaag
T1UGT5_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacagggtgaccaag
T1UHZ2_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacatagtgaccaag
A0A097I4T0_E1B19K-      aatatgccaagatagccctgcgcccagattgcaagtacatggtgaccaag
A0A3S6PYX7_E1B19K-      aatatgccaagatagccctgcgcccagattgcaagtacatggtgaccaag
T1UKV6_E1B19K-02        agtatgccaagatagccctgcgcccagattgcaagtacagggtgaccaag
T1UHQ8_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacatagtgaccaag
T1UGX3_E1B19K-02        aatatgccaagatagccctacgcccagattgcaagtacagggtgaccaag
T1ULP4_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacatagtgaccaag
G3CK71_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacagggtgaccaag
T1UHH6_E1B19K-02        aatatgccaagatagccctgcgcccagattgcaagtacatagtgaccaag
A0A0G2UY10_E1B19K-      aatatgccaagatagccttgcgcccagattgcaagtacagggtgaccaag
A0A384ZUF2_E1B19K-      agtatgccaagatagccctgcgcccagattgcaagtacatagtgaccaag
T1UHG3_E1B19K-02        agtatgccaagatagccctgcgcccagattgcaagtacatagtgaccaag
A0A075TSZ1_E1B19K-      aatatgccaagatagccctgcgtccagattgcaagtacagggtgaccaag
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        accgtgaatattaaacatgcctgctatatctcggggaacggggcagaggt
T1UGY3_E1B19K-02        accgtgaatattaaacatgcctgctacatctcgggaaacggggcagaggt
T1UGU0_E1B19K-02        acggtaaatatcagacatgcctgctacatctcagggaacggggcagaggt
T1UKQ0_E1B19K-02        acggtgaatatcagacatgcctgctacatctcagggaacggagcagaggt
T1UK99_E1B19K-02        acggtgaatatcagacatgcctgctacatctcagggaacggggcagaggt
T1UKP8_E1B19K-02        acggtgaatattagacatgcctgctacatctcagggaacggggcagaggt
T1ULJ8_E1B19K-02        acggtgaatatcagacatgcctgctacatctcagggaacggggcagaggt
A0A384ZUM9_E1B19K-      accgtgaatatcagacatgcctgctacatctcggggaacggggcagaggt
F8UFP5_E1B19K-02        acggtgaatatcagacatgcctgctacatctcagggaacggggcagaggt
T1UGT5_E1B19K-02        acggtgaatatcagacatgcctgctacatctcaggcaatggggcagaggt
T1UHZ2_E1B19K-02        accgtgaatattagacatgcctgctacatttcagggaacggggcagaggt
A0A097I4T0_E1B19K-      accgtgaatattagacatgcctgctacatctcggggaacggggcagaggt
A0A3S6PYX7_E1B19K-      accgtgaatattagacatgcctgctacatctcggggaacggggcagaggt
T1UKV6_E1B19K-02        acggtgaatatcagacatgcctgctacatctcggggaacggggcagaggt
T1UHQ8_E1B19K-02        accgtgaatatcagacatgcctgctacatctcggggaacggggcagaggt
T1UGX3_E1B19K-02        acggtgcatatcagacatgcctgctacatctcagggaacggggcagaggt
T1ULP4_E1B19K-02        accgtgaatatcagacatgcctgctacatttcgggaaacggggcagaggt
G3CK71_E1B19K-02        accgtgaatatcagacatgcctgctacatctcagggaacggggcagaggt
T1UHH6_E1B19K-02        acagtgaatatcagacatgcctgctacatctcggggaacggggcagaggt
A0A0G2UY10_E1B19K-      accgtgaatatcagacatgcctgctacatctcggggaacggggcagaggt
A0A384ZUF2_E1B19K-      accgtgaatatcagacatgcctgctacatctcggggaacggggcagaggt
T1UHG3_E1B19K-02        accgtgaatatcagacatgcctgctacatctcggggaacggggcagaggt
A0A075TSZ1_E1B19K-      acggtgaatatcagacatgcctgctacatctcggggaacggggcagaggt
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        ggacatcgatactctggacaagtcagccttcaggtgttgcatgatgggaa
T1UGY3_E1B19K-02        ggacatcgatactctggacaagtcagcctttaggtgttgcatgatgggaa
T1UGU0_E1B19K-02        gatcatcgataccctggataaggctgccttcaggtgttgcatgatgggaa
T1UKQ0_E1B19K-02        gatcattgataccctggataaggctgccttcaggtgttgcatgatgggaa
T1UK99_E1B19K-02        ggtcatcgataccctggacaagtctgccttcaggtgttgcatgatgggaa
T1UKP8_E1B19K-02        gatgatcgataccctggacaagtcagctttcaggtgttgcatgatgggaa
T1ULJ8_E1B19K-02        ggtcatcgataccctggacaagtcagcattcaggtgttgcatgatgggaa
A0A384ZUM9_E1B19K-      ggtcatcgataccctggacaagtcagccttcaggtgttgcatgatgggaa
F8UFP5_E1B19K-02        ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
T1UGT5_E1B19K-02        ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
T1UHZ2_E1B19K-02        ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
A0A097I4T0_E1B19K-      ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
A0A3S6PYX7_E1B19K-      ggttattgataccctggacaaggccgcctttaggtgttgcatgatgggaa
T1UKV6_E1B19K-02        ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
T1UHQ8_E1B19K-02        ggtcattgataccctggacaaggccgcctttaggtgttgcatgatgggaa
T1UGX3_E1B19K-02        ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
T1ULP4_E1B19K-02        ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
G3CK71_E1B19K-02        ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
T1UHH6_E1B19K-02        ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
A0A0G2UY10_E1B19K-      ggtcatcgataccctggacaaggccgcctttaggtgttgcatgatgggaa
A0A384ZUF2_E1B19K-      ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
T1UHG3_E1B19K-02        ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
A0A075TSZ1_E1B19K-      ggtcatcgataccctggacaaggccgccttcaggtgttgcatgatgggaa
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        tgagagcaggagtaatgaatatgaattccatgatctttataaacataaag
T1UGY3_E1B19K-02        tgagagcaggagtaatgaatatgaattccatgatctttataaacataaag
T1UGU0_E1B19K-02        tgagagccggtgtgatgaatatgaattcaatgatattcatgaacatcaag
T1UKQ0_E1B19K-02        tgagagccggtgtgatgaatatgaattcaatgatattcatgaacatcaag
T1UK99_E1B19K-02        tgagagccggtgtgatgaatatgaattccatgatctttatgaacatgaag
T1UKP8_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatcttcatgaacatgaag
T1ULJ8_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatcttcatgaacatgaag
A0A384ZUM9_E1B19K-      tgagagccggagtgatgaatatgaattccatgatctttatgaatatgaag
F8UFP5_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatcttcatgaacatgaag
T1UGT5_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatcttcatgaacatgaag
T1UHZ2_E1B19K-02        tgagagcaggagtgatgaatatgaattccatgatcttcatgaacatgaag
A0A097I4T0_E1B19K-      tgagagcaggagtgatgaatatgaattccatgatcttcatgaacatgaag
A0A3S6PYX7_E1B19K-      tgagagcaggagtgatgaatatgaattccatgatcttcatgaacatgaag
T1UKV6_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatctttatgaacataaag
T1UHQ8_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatctttatgaacatgaag
T1UGX3_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatctttatgaacatgaag
T1ULP4_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatcttcatgaacatgaag
G3CK71_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatcttcatgaacatgaag
T1UHH6_E1B19K-02        tgagagccggagtgatgaatatgaattccatgatcttcatgaacatgaag
A0A0G2UY10_E1B19K-      tgagagccggagtgatgaatatgaattccatgatcttcatgaacatgaag
A0A384ZUF2_E1B19K-      tgagagcaggagtgatgaatatgaattccatgatcttcatgaacatgaag
T1UHG3_E1B19K-02        tgagagcaggagtgatgaatatgaattccatgatcttcatgaacatgaag
A0A075TSZ1_E1B19K-      tgagagcaggagtgatgaatatgaattccatgatcttcatgaacatgaag
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        ttcaatggagagaagtttaatggggtactgtttatggccaacagccacat
T1UGY3_E1B19K-02        ttcaatggagagaagtttaatggggtactgtttatggccaacagccacat
T1UGU0_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
T1UKQ0_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccatat
T1UK99_E1B19K-02        tttaatggagagaagtttaatggggtgctgttcatggccaacagccacat
T1UKP8_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
T1ULJ8_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
A0A384ZUM9_E1B19K-      ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
F8UFP5_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
T1UGT5_E1B19K-02        ttcaatggagagaagtttaatggggtgctgtttatggccaacagccacat
T1UHZ2_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
A0A097I4T0_E1B19K-      ttcaatggagagaagtttaatggggtgctgttcatggctaacagccacat
A0A3S6PYX7_E1B19K-      ttcaatggagagaagtttaatggggtgctgttcatggctaacagccacat
T1UKV6_E1B19K-02        ttcaatggagagaagtttaatggggtgcttttcatggccaacagccacat
T1UHQ8_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
T1UGX3_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
T1ULP4_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
G3CK71_E1B19K-02        ttcaatggagagaagtttaatggggtgatgttcatggccaacagccacat
T1UHH6_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
A0A0G2UY10_E1B19K-      ttcaatggagagaagtttaatggggtgatgttcatggccaacagccacat
A0A384ZUF2_E1B19K-      ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
T1UHG3_E1B19K-02        ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
A0A075TSZ1_E1B19K-      ttcaatggagagaagtttaatggggtgctgttcatggccaacagccacat
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        gaccctgcatggttgcagtttttttggctttaacaatatgtgtgcagagg
T1UGY3_E1B19K-02        gaccctgcatggttgcagtttttttggctttaacaatatgtgtgcagagg
T1UGU0_E1B19K-02        gaccctgcacggctgtaatttctttggctttaacaacatgtgtgcagaag
T1UKQ0_E1B19K-02        gaccctacacggctgtaatttctttggctttaacaacatgtgtgcagaag
T1UK99_E1B19K-02        gaccctgcacggctgcagcttcttcggtttcaacaacatgtgtgccgagg
T1UKP8_E1B19K-02        gaccgtacatggctgcagcttcttcggtttcaacaacatgtgtgcagagg
T1ULJ8_E1B19K-02        gaccctgcatggttgcagcttcttcggtttcaacaacatgtgcgccgagg
A0A384ZUM9_E1B19K-      gaccctgcatggctgcagcttctttggtttcaacaacatgtgtgcagagg
F8UFP5_E1B19K-02        gaccctgcatggctgtgatttcttcggcttcaacaatatgtgtgcagagg
T1UGT5_E1B19K-02        gacactgcatggctgtgatttcttcggcttcaacaatatgtgtgcagagg
T1UHZ2_E1B19K-02        gaccctgcatggctgcagtttctttggcttcaacaatatgtgcgccgagg
A0A097I4T0_E1B19K-      gaccctgcatggctgcagtttttttggcttcaacaatatgtgcgccgagg
A0A3S6PYX7_E1B19K-      gaccctgcatggctgcagtttttttggcttcaacaatatgtgcgccgagg
T1UKV6_E1B19K-02        gaccctgcacggctgcagtttctttgggttcaacaatatgtgtgcagagg
T1UHQ8_E1B19K-02        gaccctgcatggctgcgactttttcggctttaacaatatgtgcgcagagg
T1UGX3_E1B19K-02        gaccctgcatggctgcgactttttcggctttaacaatatgtgcgcagagg
T1ULP4_E1B19K-02        gaccctgcatggctgcagtttctttggcttcaacaatatgtgtgcagagg
G3CK71_E1B19K-02        gaccctgcacggatgcagtttcttcggcttcaacaatatgtgtgccgagg
T1UHH6_E1B19K-02        gaccctgcatggctgcagtttctttggcttcaacaatatgtgtgcagagg
A0A0G2UY10_E1B19K-      gaccctgcatggctgcagtttctttggtttcaacaatatgtgtgcagagg
A0A384ZUF2_E1B19K-      gaccctgcatggctgcagtttcttcggcttcaacaatatgtgcgcagagg
T1UHG3_E1B19K-02        gaccctgcatggctgcagtttcttcggcttcaacaatatgtgcgcagagg
A0A075TSZ1_E1B19K-      gaccctgcatggctgcaatttcttcggcttcaacaatatgtgcgcagagg
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        tctggggtgctgctaagattaggggatgtaagttttacggctgctggatg
T1UGY3_E1B19K-02        tctggggtgctgctaagattaggggatgtaagttttacggctgctggatg
T1UGU0_E1B19K-02        tctggggtgcttccaagatcaggggctgtaagttttatggctgctggatg
T1UKQ0_E1B19K-02        tctggggtgcttccaagatcaggggatgtaagttttatggctgctggatg
T1UK99_E1B19K-02        tctggggagctgctaagatcaggggctgtaagttttatggctgctggatg
T1UKP8_E1B19K-02        tctggggagctgctaagatcaggggctgtaagttttatggctgctggatg
T1ULJ8_E1B19K-02        tctggggagctgctaagatcaggggctgtaagttttatggctgctggatg
A0A384ZUM9_E1B19K-      tctggggagctgctaagatcaggggctgtaagttttatggctgctggatg
F8UFP5_E1B19K-02        tctggggcgccgctaagatcaggggatgtaagttttatggctgttggatg
T1UGT5_E1B19K-02        tctggggcgccgctaagatcaggggatgtaagttttatggctgctggatg
T1UHZ2_E1B19K-02        tctggggcgcttccaagatcaggggatgtaagttttatggctgctggatg
A0A097I4T0_E1B19K-      tctggggtgcttccaaggtcaggggatgtaagttttatggctgctggatg
A0A3S6PYX7_E1B19K-      tctggggtgcttccaaggtcaggggatgtaagttttatggctgctggatg
T1UKV6_E1B19K-02        tctggggtgcctccaagatcaggggatgtaagttttatggctgctggatg
T1UHQ8_E1B19K-02        tctggggcgcttccaagatcaggggatgtaagttttatggctgctggatg
T1UGX3_E1B19K-02        tctggggcgcttccaagatcaggggatgtaagttttatggctgctggatg
T1ULP4_E1B19K-02        tctggggcgcttccaagatcaggggatgtaagttttatggctgctggatg
G3CK71_E1B19K-02        tgtggggcgctgctaagatcaggggatgtaagttttatggctgctggatg
T1UHH6_E1B19K-02        tctggggcgctgctaagatcaggggatgtaagttttatggctgctggatg
A0A0G2UY10_E1B19K-      tctggggcgctgctaagatcaggggatgtaagttttatggctgctggatg
A0A384ZUF2_E1B19K-      tctggggcgcttccaagatcaggggatgtaagttttatggctgctggatg
T1UHG3_E1B19K-02        tctggggcgcttccaagatcaggggatgtaagttttatggctgctggatg
A0A075TSZ1_E1B19K-      tctggggcgccgctaagatcaggggatgtaagttttatggctgctggatg
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        ggcgtggttggaagacccaagagcgagatgtctgtaaagcagtgtgtgtt
T1UGY3_E1B19K-02        ggcgtggttggaagacccaagagcgagatgtctgtaaagcagtgtgtgtt
T1UGU0_E1B19K-02        ggagtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1UKQ0_E1B19K-02        ggagttgtcggaaggcccaagagcgagatgtctgtgaagcagtgtgtgtt
T1UK99_E1B19K-02        ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1UKP8_E1B19K-02        ggagtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1ULJ8_E1B19K-02        ggagtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
A0A384ZUM9_E1B19K-      ggagtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
F8UFP5_E1B19K-02        ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1UGT5_E1B19K-02        ggcgtggtcggaagacccaagagcgagatgtccgtgaagcagtgcgtgtt
T1UHZ2_E1B19K-02        ggcgtggtcggaagacctaagagcgagatgtctgtgaagcagtgtgtgtt
A0A097I4T0_E1B19K-      ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
A0A3S6PYX7_E1B19K-      ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1UKV6_E1B19K-02        ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1UHQ8_E1B19K-02        ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1UGX3_E1B19K-02        ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1ULP4_E1B19K-02        ggcgtggttggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
G3CK71_E1B19K-02        ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1UHH6_E1B19K-02        ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
A0A0G2UY10_E1B19K-      ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
A0A384ZUF2_E1B19K-      ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
T1UHG3_E1B19K-02        ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
A0A075TSZ1_E1B19K-      ggcgtggtcggaagacccaagagcgagatgtctgtgaagcagtgtgtgtt
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        tgaaaaatgctacctgggagtctgtaccgagggcaatgctagagtaagac
T1UGY3_E1B19K-02        tgaaaaatgctacctgggagtctgtaccgagggcaatgctagagtaagac
T1UGU0_E1B19K-02        tgagaagtgctacctggccgtgtctaccgagggcaatgctagagtgagac
T1UKQ0_E1B19K-02        tgagaagtgctacctggccgtgtctaccgagggcaatgctagagtgagac
T1UK99_E1B19K-02        tgagaagtgctacctgggggtgtctacagagggcaatgctcgagtgagac
T1UKP8_E1B19K-02        tgagaagtgctacctgggggtgtctacagagggcaatgctagagtgagac
T1ULJ8_E1B19K-02        tgagaagtgctacctgggggtgtctacagagggcaatgctagagtgagac
A0A384ZUM9_E1B19K-      tgagaagtgctacctgggggtgtctaccgagggcaatgctagagtgagac
F8UFP5_E1B19K-02        tgagaaatgctacctgggagtctctaccgagggcaatgctcgagtgagac
T1UGT5_E1B19K-02        tgagaaatgctacctggcggtctctaccgagggcaatgctcgagtgagac
T1UHZ2_E1B19K-02        tgagaaatgctacctgggagtctctaccgagggcaatgctagagtgagac
A0A097I4T0_E1B19K-      tgagaaatgctacctgggagtctctaccgagggcaatgctagagtgagac
A0A3S6PYX7_E1B19K-      tgagaaatgctacctgggagtctctaccgagggcaatgctagagtgagac
T1UKV6_E1B19K-02        tgagaaatgctacctgggagtctctaccgagggcaatgctagagtgagac
T1UHQ8_E1B19K-02        tgagaaatgctacctgggagtctctaccgagggcaatgctagagtgaggc
T1UGX3_E1B19K-02        tgagaaatgctacctgggagtctctaccgagggcaatgctagagtgagac
T1ULP4_E1B19K-02        tgagaaatgctacctgggagtctctactgagggcaatgctagagtgagac
G3CK71_E1B19K-02        tgagaaatgctacctgggagtctctaccgagggcaatgctagagtgagac
T1UHH6_E1B19K-02        tgagaaatgctacctgggagtctctactgagggcaatgctagagtgagac
A0A0G2UY10_E1B19K-      tgagaaatgctacctgggagtctctactgagggcaatgctagagtgagac
A0A384ZUF2_E1B19K-      tgagaaatgctacctgggagtctctaccgagggcaatgctagagtgagac
T1UHG3_E1B19K-02        tgagaaatgctacctgggagtctctaccgagggcaatgctagagtgagac
A0A075TSZ1_E1B19K-      tgagaaatgctacctggcagtctctaccgagggcaatgctagagtgagac
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        actgctcttccctagagacgggctgcttttgcctggtgaagggcacagcc
T1UGY3_E1B19K-02        actgctcttccctagaaacgggctgcttttgcctggtgaagggcacagcc
T1UGU0_E1B19K-02        attgctcttccatggagacgggctgcttctgcctggtgaagggcacagct
T1UKQ0_E1B19K-02        attgctcttccatggagacgggttgcttctgcctggtgaagggtacagcc
T1UK99_E1B19K-02        actgctcttccctggagacgggctgcttttgcctggtgaagggcacagcc
T1UKP8_E1B19K-02        attgctcttccctggagacgggctgcttctgcctggtgaagggcacagct
T1ULJ8_E1B19K-02        attgctcttccctggagacgggctgcttctgcctggtgaagggcacagct
A0A384ZUM9_E1B19K-      actgctcttccctggagacgggctgcttctgcctggtgaagggcacagcc
F8UFP5_E1B19K-02        actgctcttccatggagacgggctgcttctgcctggtgaagggcacagcc
T1UGT5_E1B19K-02        actgctcttccatggagacgggctgcttctgcctggtgaagggcacagcc
T1UHZ2_E1B19K-02        actgctcttccctggatacgggctgcttctgcctggtgaagggtacggcc
A0A097I4T0_E1B19K-      actgctcttccctggatacgggctgcttctgcctggtgaagggcacagct
A0A3S6PYX7_E1B19K-      actgctcttccctggatacgggctgcttctgcctggtgaagggcacagct
T1UKV6_E1B19K-02        actgctcttccctggagacgggctgcttctgcctggtgaagggcacggcc
T1UHQ8_E1B19K-02        actgctcttccctggagacgggctgcttctgcctggtgaagggcacagcc
T1UGX3_E1B19K-02        actgctcttccctggagacgggctgcttctgcctggtgaagggcacagcc
T1ULP4_E1B19K-02        actgttcttccatggagacgggctgcttctgcctggtgaagggcacagcc
G3CK71_E1B19K-02        attgctcttccttggagacgggctgcttctgcctggtgaagggcacagcc
T1UHH6_E1B19K-02        actgctcttccatggagacgggctgcttctgcctggtgaagggcacagcc
A0A0G2UY10_E1B19K-      actgctcttccctggagacgggctgcttctgcctggtgaagggcacggcc
A0A384ZUF2_E1B19K-      actgctcttccctggagacgggctgcttctgcctggtgaagggcacagcc
T1UHG3_E1B19K-02        actgctcttccctggagacgggctgcttctgcctggtgaagggcacagcc
A0A075TSZ1_E1B19K-      actgctcttccctggagacgggctgcttctgcctggtgaagggcacagcc
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        tcgattaagcataatgtggtaaagggctgcacggatgagcgcatgtacaa
T1UGY3_E1B19K-02        tcaattaagcataatgtggtaaagggctgcacggatgagcgcatgtacaa
T1UGU0_E1B19K-02        tctatcaagcataatgtgatcaaggggtgtactgatgagcgcatgtacaa
T1UKQ0_E1B19K-02        tcgatcaagcataatgtgatcaaggggtgtactgatgagcgcatgtacaa
T1UK99_E1B19K-02        tcgatcaagcataatgtggtgaaaggctgcacggatgagcgcatgtataa
T1UKP8_E1B19K-02        tcgatcaagcataatgtggtgaaaggctgcacggatgagcgcatgtacaa
T1ULJ8_E1B19K-02        tcgatcaagcataatgtggtgaaaggctgcacggatgagcgcatgtacaa
A0A384ZUM9_E1B19K-      tctctgaagcataatgtggtgaagggctgtacggatgagcgcatgtacaa
F8UFP5_E1B19K-02        tcgatcaagcataatatggtgaagggctgcacggatgagcgcatgtacaa
T1UGT5_E1B19K-02        tcgatcaagcataatgtggtgaagggctgcacggatgagcgcatgtacaa
T1UHZ2_E1B19K-02        tctttgaagcataatatggtgaagggctgcacagatgagcgcatgtacaa
A0A097I4T0_E1B19K-      tctatcaagcataatgtggtgaagggctgcacggatgagcgcatgtacaa
A0A3S6PYX7_E1B19K-      tctatcaagcataatgtggtgaagggctgcacggatgagcgcatgtacaa
T1UKV6_E1B19K-02        tctctgaagcataatatggtgaagggctgcacggatgagcgcatgtacaa
T1UHQ8_E1B19K-02        tctctgaagcataatatggtgaagggctgcacggatgagcgcatgtacaa
T1UGX3_E1B19K-02        tctctgaagcataatatggtgaagggctgcacggatgagcgcatgtacaa
T1ULP4_E1B19K-02        tctctgaagcataatatggtgaagggctgcactgatgagcgcatgtacaa
G3CK71_E1B19K-02        tctctgaagcataatatggtgaagggctgcacggatgagcgcatgtacaa
T1UHH6_E1B19K-02        tctctgaagcataatgtggtgaagggctgtacggatgagcgcatgtacaa
A0A0G2UY10_E1B19K-      tctctgaagcataatatggtgaagggctgcacggatgagcgcatgtacaa
A0A384ZUF2_E1B19K-      tctctgaagcataatatggtgaagggctgcacggatgagcgcatgtacaa
T1UHG3_E1B19K-02        tctctgaagcataatatggtgaagggctgcacggatgagcgcatgtacaa
A0A075TSZ1_E1B19K-      tctctgaagcataatatggtgaagggctgcacggatgagcgcatgtacaa
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        catgctgacctgcgactcgggggtctgccatatcctgaagaacatccatg
T1UGY3_E1B19K-02        catgctgacctgcgactcgggggtctgccatatcctgaagaacattcatg
T1UGU0_E1B19K-02        catgctgacctgcgactctggggtctgccatatcctgaagaacatccatg
T1UKQ0_E1B19K-02        catgctgacctgcgactctggggtctgccatatcctgaagaacatccatg
T1UK99_E1B19K-02        catgctgacctgcgactcaggggtctgccatatcctgaagaatatccatg
T1UKP8_E1B19K-02        catgctgacctgcgactcaggggtctgtcatatcctgaagaacatccatg
T1ULJ8_E1B19K-02        catgctgacctgcgactcaggggtctgttatatcctgaagaacatccatg
A0A384ZUM9_E1B19K-      catgctgacctgcgattcaggggtctgccatatcctgaagaacatccatg
F8UFP5_E1B19K-02        catgctgacctgcgactcgggggtctgccatatcctgaagaacatccatg
T1UGT5_E1B19K-02        catgctgacctgcgactcgggggtctgccatatcctgaagaacatccatg
T1UHZ2_E1B19K-02        catgctaacatgcgactcgggggtctgtcatatcctgaagaacatccatg
A0A097I4T0_E1B19K-      catgctgacctgcgactcgggggtctgccatatcctgaaaaacatccatg
A0A3S6PYX7_E1B19K-      catgctgacctgcgactcgggggtctgccatatcctgaaaaacatccatg
T1UKV6_E1B19K-02        catgctgacctgcgactcgggggtctgccatatcctgaagaacatccatg
T1UHQ8_E1B19K-02        catgctgacctgcgactcgggggtctgtcatatcctgaagaacatccatg
T1UGX3_E1B19K-02        catgctgacatgcgactcgggggtctgccatattctgaagaacatccatg
T1ULP4_E1B19K-02        catgctgacctgcgactcgggggtctgtcatattctgaagaacatccatg
G3CK71_E1B19K-02        catgctgacctgcgactcgggggtctgtcatatcctgaagaacatccatg
T1UHH6_E1B19K-02        catgctgacctgcgactcgggggtctgccatatcctgaagaacatccatg
A0A0G2UY10_E1B19K-      catgctgacctgcgactcgggggtctgccatatcctgaagaacatccatg
A0A384ZUF2_E1B19K-      catgctgacctgcgattcgggggtctgccatatcctgaagaacatccatg
T1UHG3_E1B19K-02        catgctgacctgcgattcgggggtctgccatatcctgaagaacatccatg
A0A075TSZ1_E1B19K-      catgctgacctgcgactcgggggtctgccatatcctgaagaacatccatg
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        tgacctcccaccccagaaaaaagtggccagtgtttgagaataacctgctg
T1UGY3_E1B19K-02        tgacctcccaccccagaaaaaagtggccagtgtttgagaataacctgctg
T1UGU0_E1B19K-02        tgacctcccaccctaggaagaggtggccatcatttgaaaataatgtcctg
T1UKQ0_E1B19K-02        tgacctcccaccccaggaagaggtggccatcatttgaaaataatgtcctg
T1UK99_E1B19K-02        tgacagcccactccagaaagaagtggccagtgtttgagaataatctgctg
T1UKP8_E1B19K-02        tgaccgcccactccagaaagaagtggccagtgtttgagaataacctgcta
T1ULJ8_E1B19K-02        tgaccgcccactccagaaagaagtggccagtgtttgagaataacctgcta
A0A384ZUM9_E1B19K-      tgacctcccacgccagaaagaagtggccagtgtttgagaataacctgctg
F8UFP5_E1B19K-02        tgacctcccaccccaggaagaagtggccagtgtttgagaataacctgctg
T1UGT5_E1B19K-02        tgacctcccaccccagaaagaagtggccattgtttgagaataacctgctg
T1UHZ2_E1B19K-02        tgacctcccaccccagaaagaagtggccagtgtttgagaataacctgctg
A0A097I4T0_E1B19K-      tgacctcccaccccagaaagaagtggccagtgtttgagaataacctgctg
A0A3S6PYX7_E1B19K-      tgacctcccaccccagaaagaagtggccagtgtttgagaataacctgctg
T1UKV6_E1B19K-02        tgacctcccaccccaggaagaagtggccagtgtttgagaataacctgctg
T1UHQ8_E1B19K-02        tgacctcccaccccagaaagaagtggccagtgtttgagaataacatgctg
T1UGX3_E1B19K-02        tgacctcccacccccggaagaagtggccagtgtttgagaataacctgctt
T1ULP4_E1B19K-02        tgacctcccaccccagaaagaagtggccagtgtttgagaataacctgctg
G3CK71_E1B19K-02        tgacctcccaccccagaaagaagtggccagtgtttgagaataacctgctg
T1UHH6_E1B19K-02        tgacatcccaccccagaaagaagtggccagtgtttgagaataacctgctg
A0A0G2UY10_E1B19K-      tgacctcccaccccagaaagaagtggccagtgtttgagaataacctgctg
A0A384ZUF2_E1B19K-      tgacctcccaccccagaaagaagtggccagtgtttgagaataacctgctg
T1UHG3_E1B19K-02        tgacctcccaccccagaaagaagtggccagtgtttgagaataacctgctg
A0A075TSZ1_E1B19K-      tgacctcccaccccagaaagaagtggccagtgtttgagaataacctgctg
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        attaagtgccatatgcacctgggtgccagaaggggcaccttccagccgta
T1UGY3_E1B19K-02        attaagtgccatatgcacctgggtgccagaaggggcaccttccagccgta
T1UGU0_E1B19K-02        atcaagtgccatgtgcacctgggagccagaaggggtaccttccagccgta
T1UKQ0_E1B19K-02        atcaagtgccacgtgcacctgggagccagaaggggtaccttccagccgta
T1UK99_E1B19K-02        atcaagtgccatatgcacctgggagccagaaggggtaccttccagccgta
T1UKP8_E1B19K-02        atcaagtgccatatgcacctgggagccagaaggggcaccttccagccgta
T1ULJ8_E1B19K-02        atcaagtgccatatgcacctgggagccagaaggggcaccttccagccgta
A0A384ZUM9_E1B19K-      atcaagtgccatatgcacctgggcgccagaaggggcacctttcagccgta
F8UFP5_E1B19K-02        atcaagtgccatatgcacctgggtgtcagaaggggtaccttccagccgta
T1UGT5_E1B19K-02        atcaagtgccatgtgcacctgggcgccagaaggggcaccttccagccgta
T1UHZ2_E1B19K-02        atcaagtgccatatgcacctgggtgccagaaggggcaccttccagccgta
A0A097I4T0_E1B19K-      atcaagtgccatatgcacctgggcgccagaaggggcaccttccagccgta
A0A3S6PYX7_E1B19K-      atcaagtgccatatgcacctgggcgccagaaggggcaccttccagccgta
T1UKV6_E1B19K-02        atcaagtgccatatgcacctgggtgccagaaggggcaccttccagccgta
T1UHQ8_E1B19K-02        atcaagtgccacatgcacctgggcgccagaaggggcaccttccagccgta
T1UGX3_E1B19K-02        atcaagtgccacgtgcacctgggtgccagaaggggcaccttccagccgta
T1ULP4_E1B19K-02        atcaagtgccatatgcacctgggcgccagaaggggcaccttccagccgta
G3CK71_E1B19K-02        atcaagtgccatatgcacctgggtgccagaaggggcaccttccagccgta
T1UHH6_E1B19K-02        atcaagtgccatatgcacctgggtgccagaaggggcaccttccagccgta
A0A0G2UY10_E1B19K-      atcaagtgccatatgcacctgggcgccagaaggggcaccttccagccgta
A0A384ZUF2_E1B19K-      atcaagtgccatatgcacctgggagccagaaggggcaccttccagccgta
T1UHG3_E1B19K-02        atcaagtgccatatgcacctgggagccagaaggggcaccttccagccgta
A0A075TSZ1_E1B19K-      atcaagtgccatatgcacctgggcgccagaaggggcaccttccagccgta
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
T1UGY3_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
T1UGU0_E1B19K-02        ccagtgcaactttagccagaccaagctgctgctggagaatgatgccttct
T1UKQ0_E1B19K-02        ccagtgcaactttagccagaccaagctgctgctggagaacgatgccttct
T1UK99_E1B19K-02        ccagtgcaactttagccagaccaagctgctgctggagaacgatgccttct
T1UKP8_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
T1ULJ8_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
A0A384ZUM9_E1B19K-      ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
F8UFP5_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
T1UGT5_E1B19K-02        ccagtgcaatcttagccagaccaagctgctgttggagaacgatgccttct
T1UHZ2_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggaaaacgatgccttct
A0A097I4T0_E1B19K-      ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
A0A3S6PYX7_E1B19K-      ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
T1UKV6_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
T1UHQ8_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
T1UGX3_E1B19K-02        ccagtgtaactttagccagaccaagctgctgttggagaacgatgccttct
T1ULP4_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
G3CK71_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
T1UHH6_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
A0A0G2UY10_E1B19K-      ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
A0A384ZUF2_E1B19K-      ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
T1UHG3_E1B19K-02        ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
A0A075TSZ1_E1B19K-      ccagtgcaactttagccagaccaagctgctgttggagaacgatgccttct
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UGY3_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UGU0_E1B19K-02        ccagggtgaacctgaacggtatctttgacatggatgtctcggtgtacaag
T1UKQ0_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UK99_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UKP8_E1B19K-02        ctagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1ULJ8_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
A0A384ZUM9_E1B19K-      ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
F8UFP5_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UGT5_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UHZ2_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
A0A097I4T0_E1B19K-      ccagggtgaacctgaatggcatctttgacatggatgtctcggtgtacaag
A0A3S6PYX7_E1B19K-      ccagggtgaacctgaatggcatctttgacatggatgtctcggtgtacaag
T1UKV6_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UHQ8_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UGX3_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1ULP4_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
G3CK71_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UHH6_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
A0A0G2UY10_E1B19K-      ccagggtgaacctgaacggcatctttgacatggatgtttcggtgtacaag
A0A384ZUF2_E1B19K-      ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
T1UHG3_E1B19K-02        ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
A0A075TSZ1_E1B19K-      ccagggtgaacctgaacggcatctttgacatggatgtctcggtgtacaag
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1UGY3_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1UGU0_E1B19K-02        atcctgagatacgatgagaccaggtccagggtgcgcgcttgcgagtgcgg
T1UKQ0_E1B19K-02        atcctgagatacgatgagaccaggtccagggtgcgcgcttgcgagtgcgg
T1UK99_E1B19K-02        atcctgagatacgatgagaccaggtccagggtgcgcgcttgcgagtgcgg
T1UKP8_E1B19K-02        atcctgagatacgatgagaccaggtccagggtgcgcgcttgcgagtgcgg
T1ULJ8_E1B19K-02        atcctgagatacgatgaaaccaggtccagggtgcgcgcttgcgagtgcgg
A0A384ZUM9_E1B19K-      atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
F8UFP5_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1UGT5_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1UHZ2_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
A0A097I4T0_E1B19K-      atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
A0A3S6PYX7_E1B19K-      atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1UKV6_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1UHQ8_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1UGX3_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1ULP4_E1B19K-02        attctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
G3CK71_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1UHH6_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
A0A0G2UY10_E1B19K-      atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
A0A384ZUF2_E1B19K-      atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
T1UHG3_E1B19K-02        atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
A0A075TSZ1_E1B19K-      atcctgagatacgatgagaccaagtccagggtgcgcgcttgcgagtgcgg
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        tggcagacacagcaggatgcagccagtggccctggatgtgaccgaggagc
T1UGY3_E1B19K-02        tggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
T1UGU0_E1B19K-02        gggcagacacaccaggatgcagcctgtggctctggatgtaaccgaggagc
T1UKQ0_E1B19K-02        gggcagacacaccaggatgcaaccagtggccctggatgtgaccgaggagc
T1UK99_E1B19K-02        gggcagacacaccaggatgcaaccggttgccctggatgtgaccgaggagc
T1UKP8_E1B19K-02        gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
T1ULJ8_E1B19K-02        gggcagacacaccaggatgcagcctgtggccctggatgtgacagaggagc
A0A384ZUM9_E1B19K-      gggcagacacaccaggatgcaaccggtggccctggatgtgaccgaggagc
F8UFP5_E1B19K-02        gggcagacacaccaggatgcaaccggtggccctggatgtgaccgaggatc
T1UGT5_E1B19K-02        gggcagacacaccaggatgcaaccagtggccctggatgtgaccgaggagc
T1UHZ2_E1B19K-02        gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
A0A097I4T0_E1B19K-      gggcagacacaccaggatgcaaccagtggccctggatgtgaccgaggagc
A0A3S6PYX7_E1B19K-      gggcagacacaccaggatgcaaccagtggccctggatgtgaccgaggagc
T1UKV6_E1B19K-02        gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
T1UHQ8_E1B19K-02        gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
T1UGX3_E1B19K-02        gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
T1ULP4_E1B19K-02        gggcagacacaccaggatgcaaccagtggccctggatgtgaccgaggagc
G3CK71_E1B19K-02        gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
T1UHH6_E1B19K-02        gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
A0A0G2UY10_E1B19K-      gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
A0A384ZUF2_E1B19K-      gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
T1UHG3_E1B19K-02        gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
A0A075TSZ1_E1B19K-      gggcagacacaccaggatgcagccagtggccctggatgtgaccgaggagc
                                                                          

T1UG22_E1B19K-01        --------------------------------------------------
T1UGY3_E1B19K-01        --------------------------------------------------
T1UGU0_E1B19K-01        --------------------------------------------------
T1UK99_E1B19K-01        --------------------------------------------------
T1UKQ0_E1B19K-01        --------------------------------------------------
X4YVU5_E1B19K-01        --------------------------------------------------
A0A291B0H2_E1B19K-      --------------------------------------------------
T1UKV6_E1B19K-01        --------------------------------------------------
A0A097I4T0_E1B19K-      --------------------------------------------------
A0A3S6PYX7_E1B19K-      --------------------------------------------------
B6DU90_E1B19K-01        --------------------------------------------------
T1UHZ2_E1B19K-01        --------------------------------------------------
A0A0G2UY10_E1B19K-      --------------------------------------------------
A0A1J0MS84_E1B19K-      --------------------------------------------------
T1UKP8_E1B19K-01        --------------------------------------------------
T1UHQ8_E1B19K-01        --------------------------------------------------
A0A384ZUM9_E1B19K-      --------------------------------------------------
T1UHG3_E1B19K-01        --------------------------------------------------
A0A384ZUF2_E1B19K-      --------------------------------------------------
E1CIR1_E1B19K-01        --------------------------------------------------
X4Y9D2_E1B19K-01        --------------------------------------------------
T1UHH6_E1B19K-01        --------------------------------------------------
T1ULJ8_E1B19K-01        --------------------------------------------------
A0A075TSZ1_E1B19K-      --------------------------------------------------
T1ULP4_E1B19K-01        --------------------------------------------------
F8UFP5_E1B19K-01        --------------------------------------------------
T1UGT5_E1B19K-01        --------------------------------------------------
G3CK71_E1B19K-01        --------------------------------------------------
T1UGX3_E1B19K-01        --------------------------------------------------
T1UG22_E1B19K-02        tgcgaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UGY3_E1B19K-02        tgcgagcagaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UGU0_E1B19K-02        tgaggcccgaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UKQ0_E1B19K-02        tgaggcccgaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UK99_E1B19K-02        tgaggcccgaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UKP8_E1B19K-02        tgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1ULJ8_E1B19K-02        tgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
A0A384ZUM9_E1B19K-      tgcggcccgaccacctggtgatggcctgtaccgggaccgagttcagctcc
F8UFP5_E1B19K-02        tgcgacccgaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UGT5_E1B19K-02        tcagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UHZ2_E1B19K-02        tgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
A0A097I4T0_E1B19K-      tgagaccagaccacctggtgatggcctgtaccggtaccgagttcagctcc
A0A3S6PYX7_E1B19K-      tgagaccagaccatctggtgatggcctgtaccgggaccgagttcagctcc
T1UKV6_E1B19K-02        tgagaccagaccacctggtgatggcctgtactggtaccgagttcagctcc
T1UHQ8_E1B19K-02        tgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UGX3_E1B19K-02        tgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1ULP4_E1B19K-02        tgcggcccgaccacctggtgatggcctgtaccgggaccgagttcagctcc
G3CK71_E1B19K-02        tgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UHH6_E1B19K-02        tgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
A0A0G2UY10_E1B19K-      tgagaccagaccacctggtgatggcatgtaccgggaccgagttcagctcc
A0A384ZUF2_E1B19K-      tgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
T1UHG3_E1B19K-02        tgagaccagaccacctggtgatggcctgtaccgggaccgagttcagctcc
A0A075TSZ1_E1B19K-      tgagacccgaccacctggtgatggcctgtaccgggaccgagtttagctcc
                                                                          

T1UG22_E1B19K-01        ---------------------
T1UGY3_E1B19K-01        ---------------------
T1UGU0_E1B19K-01        ---------------------
T1UK99_E1B19K-01        ---------------------
T1UKQ0_E1B19K-01        ---------------------
X4YVU5_E1B19K-01        ---------------------
A0A291B0H2_E1B19K-      ---------------------
T1UKV6_E1B19K-01        ---------------------
A0A097I4T0_E1B19K-      ---------------------
A0A3S6PYX7_E1B19K-      ---------------------
B6DU90_E1B19K-01        ---------------------
T1UHZ2_E1B19K-01        ---------------------
A0A0G2UY10_E1B19K-      ---------------------
A0A1J0MS84_E1B19K-      ---------------------
T1UKP8_E1B19K-01        ---------------------
T1UHQ8_E1B19K-01        ---------------------
A0A384ZUM9_E1B19K-      ---------------------
T1UHG3_E1B19K-01        ---------------------
A0A384ZUF2_E1B19K-      ---------------------
E1CIR1_E1B19K-01        ---------------------
X4Y9D2_E1B19K-01        ---------------------
T1UHH6_E1B19K-01        ---------------------
T1ULJ8_E1B19K-01        ---------------------
A0A075TSZ1_E1B19K-      ---------------------
T1ULP4_E1B19K-01        ---------------------
F8UFP5_E1B19K-01        ---------------------
T1UGT5_E1B19K-01        ---------------------
G3CK71_E1B19K-01        ---------------------
T1UGX3_E1B19K-01        ---------------------
T1UG22_E1B19K-02        agtggggaggacacagattag
T1UGY3_E1B19K-02        agtggggaggacacagattag
T1UGU0_E1B19K-02        agcggggaggacacagattag
T1UKQ0_E1B19K-02        agcggggaggacacagattag
T1UK99_E1B19K-02        agcggggaggacacagattag
T1UKP8_E1B19K-02        agtggggaggacacagattag
T1ULJ8_E1B19K-02        agtggggaggacacagattag
A0A384ZUM9_E1B19K-      agtggggaggacacagattag
F8UFP5_E1B19K-02        agtggggaggacacagattag
T1UGT5_E1B19K-02        agtggggaggacacagattag
T1UHZ2_E1B19K-02        agtggggaggacacagattag
A0A097I4T0_E1B19K-      agtggggaggacacagattag
A0A3S6PYX7_E1B19K-      agtggggaggacacagattag
T1UKV6_E1B19K-02        agtggggaggacacagattag
T1UHQ8_E1B19K-02        agtggggaggacacagattag
T1UGX3_E1B19K-02        agtggggaggacacagattag
T1ULP4_E1B19K-02        agtggggaggacacagattag
G3CK71_E1B19K-02        agtggggaggacacagattag
T1UHH6_E1B19K-02        agtggggaggacacagattag
A0A0G2UY10_E1B19K-      agtggggaggacacagattag
A0A384ZUF2_E1B19K-      agtggggaggacacagattag
T1UHG3_E1B19K-02        agtggggaggacacagattag
A0A075TSZ1_E1B19K-      agtggggaggacacagattag
                                             

© 1998-2022Legal notice