Dataset for CDS E1B19K of organism Human mastadenovirus C

[Download (right click)] [Edit] [Sequences] [Repertoires]

21 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A0G2R248_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
A0A3Q9HK78_E1B19K-      atgtttaacttgcatggcgtgttaaatggggcggggcttaaagggtatat
A0A3Q9HK00_E1B19K-      atgtttaacttgcatggcgtgttaaatggggcggggcttaaagggtatat
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      atgtttaacttgcatggcgtgttaaatggggcggggcttaaagggtatat
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
                                                                          

A0A0G2R248_E1B19K-      -------------------------------------atggaggcttggg
A0A291P1B2_E1B19K-      -------------------------------------atggagacttggg
T1UG63_E1B19K-01        -------------------------------------atggaggcttggg
A0A3S9SND6_E1B19K-      -------------------------------------atggaggcttggg
A0A3S9SNH4_E1B19K-      -------------------------------------atggaggcttggg
A0A3Q9HJZ5_E1B19K-      -------------------------------------atggaggcttggg
J9Z4H6_E1B19K-01        -------------------------------------atggaggcttggg
A0A3Q9HK78_E1B19K-      aatgcgccgtgggctaatcttggttacatttgacctcatggaggcttggg
A0A3Q9HK00_E1B19K-      aatgcgccgtgggctaatcttggttacatttgacctcatggaggcttggg
A0A2H4PJ75_E1B19K-      -------------------------------------atggaggcttggg
A0A3Q9HJ63_E1B19K-      -------------------------------------atggaggcttggg
A0A3S9SPV1_E1B19K-      aatgcgccgtgggctaatcttggttacatttgacctcatggaggcttggg
J7I6T8_E1B19K-01        -------------------------------------atggaggcttggg
A0A3Q9HJ54_E1B19K-      -------------------------------------atggaggcttggg
J9Z5H0_E1B19K-01        -------------------------------------atggaggcttggg
A0A3S9SP19_E1B19K-      -------------------------------------atggaggcttggg
A0A3S9SSS2_E1B19K-      -------------------------------------atggaggcttggg
E1ARN8_E1B19K-01        -------------------------------------atggaggcttggg
J9Z4N4_E1B19K-01        -------------------------------------atggaggcttggg
A0A3Q9HLF7_E1B19K-      -------------------------------------atggaggcttggg
A0A3S9SNY0_E1B19K-      -------------------------------------atggaggcttggg
                                                             ****** ******

A0A0G2R248_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A291P1B2_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
T1UG63_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SND6_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SNH4_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HJZ5_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
J9Z4H6_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HK78_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HK00_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A2H4PJ75_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HJ63_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SPV1_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
J7I6T8_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HJ54_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
J9Z5H0_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SP19_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SSS2_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
E1ARN8_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
J9Z4N4_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgttggaacagagctct
A0A3Q9HLF7_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SNY0_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
                        *********************************** **************

A0A0G2R248_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcatcccaggcaaa
A0A291P1B2_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
T1UG63_E1B19K-01        aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SND6_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SNH4_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HJZ5_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
J9Z4H6_E1B19K-01        aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HK78_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HK00_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A2H4PJ75_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HJ63_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SPV1_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
J7I6T8_E1B19K-01        aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HJ54_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
J9Z5H0_E1B19K-01        aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SP19_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SSS2_E1B19K-      aacagtacctcctggttttggaggtttctgtggggctcctcccaggcaaa
E1ARN8_E1B19K-01        aacagtacctcctggttttggaggtttctgtggggctcctcccaggcaaa
J9Z4N4_E1B19K-01        aacagtacctcctggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HLF7_E1B19K-      aacagtacctcctggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SNY0_E1B19K-      aacagtacctcctggttttggaggtttctgtggggctcctgccaggcaaa
                        *********** ************************** * *********

A0A0G2R248_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A291P1B2_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
T1UG63_E1B19K-01        gttagtttgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SND6_E1B19K-      gttagtctgcagagttaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SNH4_E1B19K-      gttagtctgcagagttaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HJZ5_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
J9Z4H6_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HK78_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HK00_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A2H4PJ75_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HJ63_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SPV1_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
J7I6T8_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HJ54_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
J9Z5H0_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SP19_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagatcttt
A0A3S9SSS2_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
E1ARN8_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
J9Z4N4_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HLF7_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SNY0_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
                        ****** ****** ******************************* ****

A0A0G2R248_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A291P1B2_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
T1UG63_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SND6_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SNH4_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HJZ5_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
J9Z4H6_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HK78_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HK00_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A2H4PJ75_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HJ63_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SPV1_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
J7I6T8_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HJ54_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
J9Z5H0_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SP19_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SSS2_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
E1ARN8_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
J9Z4N4_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HLF7_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SNY0_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
                        **************************************************

A0A0G2R248_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A291P1B2_E1B19K-      cttttccaagagaaggtcattaagactttggatttttccacaccggggcg
T1UG63_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SND6_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SNH4_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HJZ5_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
J9Z4H6_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HK78_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HK00_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A2H4PJ75_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HJ63_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SPV1_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
J7I6T8_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HJ54_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
J9Z5H0_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SP19_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SSS2_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
E1ARN8_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
J9Z4N4_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HLF7_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SNY0_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
                        ******************** *****************************

A0A0G2R248_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A291P1B2_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
T1UG63_E1B19K-01        cactgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SND6_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SNH4_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HJZ5_E1B19K-      cgttgcggctgctgttgcttttttgagttttataaaggataaatggagcg
J9Z4H6_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HK78_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HK00_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A2H4PJ75_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HJ63_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SPV1_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
J7I6T8_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HJ54_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
J9Z5H0_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SP19_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SSS2_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
E1ARN8_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
J9Z4N4_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HLF7_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SNY0_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
                        *  ***********************************************

A0A0G2R248_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A291P1B2_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
T1UG63_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SND6_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SNH4_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HJZ5_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J9Z4H6_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HK78_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HK00_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A2H4PJ75_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HJ63_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SPV1_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J7I6T8_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HJ54_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J9Z5H0_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SP19_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SSS2_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
E1ARN8_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J9Z4N4_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HLF7_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SNY0_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
                        **************************************************

A0A0G2R248_E1B19K-      ctgtggagagcggttgtgagacacaagaatcgcctgctactgttgtcttc
A0A291P1B2_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
T1UG63_E1B19K-01        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3S9SND6_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcatgctactgttgtcttc
A0A3S9SNH4_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcatgctactgttgtcttc
A0A3Q9HJZ5_E1B19K-      ctgtggagagcggtggtgagacacaagaatggcctgctactgttgtcttc
J9Z4H6_E1B19K-01        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HK78_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HK00_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A2H4PJ75_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HJ63_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3S9SPV1_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
J7I6T8_E1B19K-01        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HJ54_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
J9Z5H0_E1B19K-01        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3S9SP19_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3S9SSS2_E1B19K-      ttgtggagagcggtggtgagacacaagaatcgcctactactgttgtcttc
E1ARN8_E1B19K-01        ttgtggagagcggtggtgagacacaagaatcgcctactactgttgtcttc
J9Z4N4_E1B19K-01        ttgtggagagcagtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HLF7_E1B19K-      ttgtggagagcagtggtgagacacaagaatcgcttgctactgttgtcttc
A0A3S9SNY0_E1B19K-      ttgtggagagcagtggtgagacacaagaatcgcttgctactgttgtcttc
                         ********** ** *************** ** * **************

A0A0G2R248_E1B19K-      cgtccgcccggcgataataccgacggagg---------------------
A0A291P1B2_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
T1UG63_E1B19K-01        cgtccgcccggcaataataccgacggagg------------------agc
A0A3S9SND6_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A3S9SNH4_E1B19K-      cgtccgcccggcaataataccgacggagg------------------agc
A0A3Q9HJZ5_E1B19K-      cgtccgcccggcaataataccgacggagg---------------agcagc
J9Z4H6_E1B19K-01        cgtccgcccggcaataataccgacggaag---------------agcagc
A0A3Q9HK78_E1B19K-      cgtccgcccggcaataataccgacggagg------------------agc
A0A3Q9HK00_E1B19K-      cgtccgcccggcaataataccgacggagg---------------agcagc
A0A2H4PJ75_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A3Q9HJ63_E1B19K-      cgtccgcccggcaataataccgacggagg------------agcagcagc
A0A3S9SPV1_E1B19K-      cgtccgcccggcaataataccgacggaggagcagcagcagcagcagcagc
J7I6T8_E1B19K-01        cgtccgcccggcaataataccgacggagg---------------------
A0A3Q9HJ54_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
J9Z5H0_E1B19K-01        cgtccgcccggcaataataccgacggagg---------------------
A0A3S9SP19_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A3S9SSS2_E1B19K-      cgtccgcccggc---aataccgacggagg------------------agc
E1ARN8_E1B19K-01        cgtccgcccggcaataataccgacggagg------------------agc
J9Z4N4_E1B19K-01        cgtccgcccggcaataataccgacggagg------------------agc
A0A3Q9HLF7_E1B19K-      cgtcagcccggcaataataccgacggagg------------------agc
A0A3S9SNY0_E1B19K-      cgtcagcccggcaataataccgacggagg------------------agc
                        **** *******   ************ *                     

A0A0G2R248_E1B19K-      ------agcag---cagcagcagcaggaggaagcca------ggcggcgg
A0A291P1B2_E1B19K-      ---------------agcaacagcaggaggaagcca---ggcggcggcgg
T1UG63_E1B19K-01        agcagcagcag---cagcagcagcaggaggaagccaggcggcggcggcgg
A0A3S9SND6_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3S9SNH4_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HJZ5_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
J9Z4H6_E1B19K-01        agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HK78_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HK00_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A2H4PJ75_E1B19K-      ---agcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HJ63_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3S9SPV1_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
J7I6T8_E1B19K-01        agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HJ54_E1B19K-      ---------------agcaacagcaggaggaagccaggcggcggcggcgg
J9Z5H0_E1B19K-01        ---------------agcaacagcaggaggaagcca---ggcggcggcgg
A0A3S9SP19_E1B19K-      ---------------agcaacagcaggaggaagcca---ggcggcggcgg
A0A3S9SSS2_E1B19K-      agcagcagcaacagcagcagcagcaggaggaagcca---ggcggcggcgg
E1ARN8_E1B19K-01        agcagcagcaa---cagcagcagcaggaggaagcca---ggcggcggcgg
J9Z4N4_E1B19K-01        ag------------cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HLF7_E1B19K-      agcagcagcaa---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3S9SNY0_E1B19K-      agcagcagcaa---cagcagcagcaggaggaagcca---ggcggcggcgg
                                       **** ****************      ********

A0A0G2R248_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A291P1B2_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
T1UG63_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SND6_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SNH4_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HJZ5_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J9Z4H6_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HK78_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HK00_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A2H4PJ75_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HJ63_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SPV1_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J7I6T8_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HJ54_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J9Z5H0_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SP19_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SSS2_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
E1ARN8_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J9Z4N4_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HLF7_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SNY0_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
                        **************************************************

A0A0G2R248_E1B19K-      atga
A0A291P1B2_E1B19K-      atga
T1UG63_E1B19K-01        atga
A0A3S9SND6_E1B19K-      atga
A0A3S9SNH4_E1B19K-      atga
A0A3Q9HJZ5_E1B19K-      atga
J9Z4H6_E1B19K-01        atga
A0A3Q9HK78_E1B19K-      atga
A0A3Q9HK00_E1B19K-      atga
A0A2H4PJ75_E1B19K-      atga
A0A3Q9HJ63_E1B19K-      atga
A0A3S9SPV1_E1B19K-      atga
J7I6T8_E1B19K-01        atga
A0A3Q9HJ54_E1B19K-      atga
J9Z5H0_E1B19K-01        atga
A0A3S9SP19_E1B19K-      atga
A0A3S9SSS2_E1B19K-      atga
E1ARN8_E1B19K-01        atga
J9Z4N4_E1B19K-01        atga
A0A3Q9HLF7_E1B19K-      atga
A0A3S9SNY0_E1B19K-      atga
                        ****

© 1998-2020Legal notice