Dataset for CDS adenoviridae of organism Human mastadenovirus C

[Download (right click)] [Edit] [Sequences] [Repertoires]

39 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      atgtttaacttgcatggcgtgttaaatggggcggggcttaaagggtatat
A0A3Q9HK00_E1B19K-      atgtttaacttgcatggcgtgttaaatggggcggggcttaaagggtatat
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      atgtttaacttgcatggcgtgttaaatggggcggggcttaaagggtatat
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      atgtttaacttgcatggcgtgttatatgggacgggccttttaggccatat
A0A0G2R248_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
                                                                          

A0A7L4WIC2_E1B19K-      -------------------------------------atggaggcttggg
A0A0G2R248_E1B19K-      -------------------------------------atggaggcttggg
A0A7D0TN91_E1B19K-      -atgcgccgtgggctaatcttggttacatctgacctcatggaggcttggg
A0A7L4WK62_E1B19K-      -------------------------------------atggaggcttggg
A0A291P1B2_E1B19K-      -------------------------------------atggagacttggg
T1UG63_E1B19K-01        -------------------------------------atggaggcttggg
A0A3S9SND6_E1B19K-      -------------------------------------atggaggcttggg
A0A3S9SNH4_E1B19K-      -------------------------------------atggaggcttggg
A0A3Q9HJZ5_E1B19K-      -------------------------------------atggaggcttggg
A0A3S9SP19_E1B19K-      -------------------------------------atggaggcttggg
A0A6M4W5T4_E1B19K-      -------------------------------------atggaggcttggg
A0A7L4WG90_E1B19K-      -------------------------------------atggaggcttggg
J9Z4H6_E1B19K-01        -------------------------------------atggaggcttggg
J9Z5H0_E1B19K-01        -------------------------------------atggaggcttggg
A0A7L4WIG2_E1B19K-      -------------------------------------atggaggcttggg
A0A3Q9HK78_E1B19K-      aatgcgccgtgggctaatcttggttacatttgacctcatggaggcttggg
A0A3Q9HK00_E1B19K-      aatgcgccgtgggctaatcttggttacatttgacctcatggaggcttggg
A0A3Q9HJ54_E1B19K-      -------------------------------------atggaggcttggg
A0A2H4PJ75_E1B19K-      -------------------------------------atggaggcttggg
A0A3Q9HJ63_E1B19K-      -------------------------------------atggaggcttggg
A0A3S9SPV1_E1B19K-      aatgcgccgtgggctaatcttggttacatttgacctcatggaggcttggg
A0A7L4WGT1_E1B19K-      -------------------------------------atggaggcttggg
A0A7L4WJT1_E1B19K-      -------------------------------------atggaggcttggg
J7I6T8_E1B19K-01        -------------------------------------atggaggcttggg
A0A3S9SSS2_E1B19K-      -------------------------------------atggaggcttggg
E1ARN8_E1B19K-01        -------------------------------------atggaggcttggg
J9Z4N4_E1B19K-01        -------------------------------------atggaggcttggg
A0A3Q9HLF7_E1B19K-      -------------------------------------atggaggcttggg
A0A3S9SNY0_E1B19K-      -------------------------------------atggaggcttggg
A0A7D0TLU2_E1B19K-      aatgcgccgtgggctaatcttggttacatctgacctcatggaggcttggg
A0A0G2R248_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
                                                                          

A0A7L4WIC2_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A0G2R248_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A7D0TN91_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A7L4WK62_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A291P1B2_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
T1UG63_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SND6_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SNH4_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HJZ5_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SP19_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A6M4W5T4_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A7L4WG90_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
J9Z4H6_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
J9Z5H0_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A7L4WIG2_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HK78_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HK00_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HJ54_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A2H4PJ75_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3Q9HJ63_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SPV1_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A7L4WGT1_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A7L4WJT1_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
J7I6T8_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SSS2_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
E1ARN8_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
J9Z4N4_E1B19K-01        agtgtttggaagatttttctgctgtgcgtaacttgttggaacagagctct
A0A3Q9HLF7_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A3S9SNY0_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A7D0TLU2_E1B19K-      agtgtttggaagatttttctgctgtgcgtaacttgctggaacagagctct
A0A0G2R248_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
                                                                          

A0A7L4WIC2_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A0G2R248_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcatcccaggcaaa
A0A7D0TN91_E1B19K-      aacagtacctcttggttttggagggttctgtggggctcctcccaggcaaa
A0A7L4WK62_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A291P1B2_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
T1UG63_E1B19K-01        aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SND6_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SNH4_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HJZ5_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SP19_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A6M4W5T4_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A7L4WG90_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
J9Z4H6_E1B19K-01        aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
J9Z5H0_E1B19K-01        aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A7L4WIG2_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HK78_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HK00_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HJ54_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A2H4PJ75_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HJ63_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SPV1_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A7L4WGT1_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A7L4WJT1_E1B19K-      aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
J7I6T8_E1B19K-01        aacagtacctcttggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SSS2_E1B19K-      aacagtacctcctggttttggaggtttctgtggggctcctcccaggcaaa
E1ARN8_E1B19K-01        aacagtacctcctggttttggaggtttctgtggggctcctcccaggcaaa
J9Z4N4_E1B19K-01        aacagtacctcctggttttggaggtttctgtggggctcctcccaggcaaa
A0A3Q9HLF7_E1B19K-      aacagtacctcctggttttggaggtttctgtggggctcctcccaggcaaa
A0A3S9SNY0_E1B19K-      aacagtacctcctggttttggaggtttctgtggggctcctgccaggcaaa
A0A7D0TLU2_E1B19K-      aacagtacctccaaaaccaagaggttactgttgagctctttccagccaaa
A0A0G2R248_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
                                                                          

A0A7L4WIC2_E1B19K-      gttagtttgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A0G2R248_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A7D0TN91_E1B19K-      gttagtttgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A7L4WK62_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A291P1B2_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
T1UG63_E1B19K-01        gttagtttgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SND6_E1B19K-      gttagtctgcagagttaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SNH4_E1B19K-      gttagtctgcagagttaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HJZ5_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SP19_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagatcttt
A0A6M4W5T4_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A7L4WG90_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
J9Z4H6_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
J9Z5H0_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A7L4WIG2_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HK78_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HK00_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HJ54_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A2H4PJ75_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HJ63_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SPV1_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A7L4WGT1_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A7L4WJT1_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
J7I6T8_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SSS2_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
E1ARN8_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
J9Z4N4_E1B19K-01        gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3Q9HLF7_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A3S9SNY0_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A7D0TLU2_E1B19K-      gttagtctgcagaattaaggaggattacaagtgggaatttgaagagcttt
A0A0G2R248_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
                                                                          

A0A7L4WIC2_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A0G2R248_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A7D0TN91_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A7L4WK62_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A291P1B2_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
T1UG63_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SND6_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SNH4_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HJZ5_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SP19_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A6M4W5T4_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A7L4WG90_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
J9Z4H6_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
J9Z5H0_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A7L4WIG2_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HK78_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HK00_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HJ54_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A2H4PJ75_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HJ63_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SPV1_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A7L4WGT1_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A7L4WJT1_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
J7I6T8_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SSS2_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
E1ARN8_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
J9Z4N4_E1B19K-01        tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3Q9HLF7_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A3S9SNY0_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A7D0TLU2_E1B19K-      tgaaatcctgtggtgagctgtttgattctttgaatctgggtcaccaggcg
A0A0G2R248_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
                                                                          

A0A7L4WIC2_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A0G2R248_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A7D0TN91_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A7L4WK62_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A291P1B2_E1B19K-      cttttccaagagaaggtcattaagactttggatttttccacaccggggcg
T1UG63_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SND6_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SNH4_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HJZ5_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SP19_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A6M4W5T4_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A7L4WG90_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
J9Z4H6_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
J9Z5H0_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A7L4WIG2_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HK78_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HK00_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HJ54_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A2H4PJ75_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HJ63_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SPV1_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A7L4WGT1_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A7L4WJT1_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
J7I6T8_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SSS2_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
E1ARN8_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
J9Z4N4_E1B19K-01        cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3Q9HLF7_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A3S9SNY0_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A7D0TLU2_E1B19K-      cttttccaagagaaggtcatcaagactttggatttttccacaccggggcg
A0A0G2R248_E1B19K-      --------------------------------------------------
J9Z5H0_E1B19K-02        --------------------------------------------------
J9Z4N4_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        --------------------------------------------------
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        --------------------------------------------------
J7I6T8_E1B19K-02        --------------------------------------------------
J9Z4H6_E1B19K-02        --------------------------------------------------
                                                                          

A0A7L4WIC2_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A0G2R248_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A7D0TN91_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A7L4WK62_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A291P1B2_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
T1UG63_E1B19K-01        cactgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SND6_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SNH4_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HJZ5_E1B19K-      cgttgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SP19_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A6M4W5T4_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A7L4WG90_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
J9Z4H6_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
J9Z5H0_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A7L4WIG2_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HK78_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HK00_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HJ54_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A2H4PJ75_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HJ63_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SPV1_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A7L4WGT1_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A7L4WJT1_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
J7I6T8_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SSS2_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
E1ARN8_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
J9Z4N4_E1B19K-01        cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3Q9HLF7_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A3S9SNY0_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A7D0TLU2_E1B19K-      cgctgcggctgctgttgcttttttgagttttataaaggataaatggagcg
A0A0G2R248_E1B19K-      ------------------------------------------atggagcg
J9Z5H0_E1B19K-02        ------------------------------------------atggagcg
J9Z4N4_E1B19K-02        ------------------------------------------atggagcg
E1ARN8_E1B19K-03        ------------------------------------------atggagcg
E1ARN8_E1B19K-02        ------------------------------------------atggagcg
E1ARN8_E1B19K-04        ------------------------------------------atggagcg
T1UG63_E1B19K-02        ------------------------------------------atggagcg
J7I6T8_E1B19K-02        ------------------------------------------atggagcg
J9Z4H6_E1B19K-02        ------------------------------------------atggagcg
                                                                  ********

A0A7L4WIC2_E1B19K-      aagaaacccatctgagcgggggatacctgctggattttctagccatgcat
A0A0G2R248_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A7D0TN91_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A7L4WK62_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A291P1B2_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
T1UG63_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SND6_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SNH4_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HJZ5_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SP19_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A6M4W5T4_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A7L4WG90_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J9Z4H6_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J9Z5H0_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A7L4WIG2_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HK78_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HK00_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HJ54_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A2H4PJ75_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HJ63_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SPV1_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A7L4WGT1_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A7L4WJT1_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J7I6T8_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SSS2_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
E1ARN8_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J9Z4N4_E1B19K-01        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3Q9HLF7_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A3S9SNY0_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A7D0TLU2_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
A0A0G2R248_E1B19K-      aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J9Z5H0_E1B19K-02        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J9Z4N4_E1B19K-02        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
E1ARN8_E1B19K-03        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
E1ARN8_E1B19K-02        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
E1ARN8_E1B19K-04        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
T1UG63_E1B19K-02        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J7I6T8_E1B19K-02        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
J9Z4H6_E1B19K-02        aagaaacccatctgagcggggggtacctgctggattttctggccatgcat
                        ********************** ***************** *********

A0A7L4WIC2_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgatactgttgtcttc
A0A0G2R248_E1B19K-      ctgtggagagcggttgtgagacacaagaatcgcctgctactgttgtcttc
A0A7D0TN91_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcctc
A0A7L4WK62_E1B19K-      ttgtggagagcggtggtgagacacaagaatcgcatgctactgttgtcttc
A0A291P1B2_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
T1UG63_E1B19K-01        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3S9SND6_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcatgctactgttgtcttc
A0A3S9SNH4_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcatgctactgttgtcttc
A0A3Q9HJZ5_E1B19K-      ctgtggagagcggtggtgagacacaagaatggcctgctactgttgtcttc
A0A3S9SP19_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A6M4W5T4_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A7L4WG90_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
J9Z4H6_E1B19K-01        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
J9Z5H0_E1B19K-01        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A7L4WIG2_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HK78_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HK00_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HJ54_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A2H4PJ75_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HJ63_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3S9SPV1_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A7L4WGT1_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A7L4WJT1_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
J7I6T8_E1B19K-01        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3S9SSS2_E1B19K-      ttgtggagagcggtggtgagacacaagaatcgcctactactgttgtcttc
E1ARN8_E1B19K-01        ttgtggagagcggtggtgagacacaagaatcgcctactactgttgtcttc
J9Z4N4_E1B19K-01        ttgtggagagcagtggtgagacacaagaatcgcctgctactgttgtcttc
A0A3Q9HLF7_E1B19K-      ttgtggagagcagtggtgagacacaagaatcgcttgctactgttgtcttc
A0A3S9SNY0_E1B19K-      ttgtggagagcagtggtgagacacaagaatcgcttgctactgttgtcttc
A0A7D0TLU2_E1B19K-      ctgtggagagcggtggtgagacacaagaatcgtctgctactgttgtctgc
A0A0G2R248_E1B19K-      ctgtggagagcggttgtgagacacaagaatcgcctgctactgttgtcttc
J9Z5H0_E1B19K-02        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
J9Z4N4_E1B19K-02        ttgtggagagcagtggtgagacacaagaatcgcctgctactgttgtcttc
E1ARN8_E1B19K-03        ttgtggagagcggtggtgagacacaagaatcgcctactactgttgtcttc
E1ARN8_E1B19K-02        ttgtggagagcggtggtgagacacaagaatcgcctactactgttgtcttc
E1ARN8_E1B19K-04        ttgtggagagcggtggtgagacacaagaatcgcctactactgttgtcttc
T1UG63_E1B19K-02        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
J7I6T8_E1B19K-02        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
J9Z4H6_E1B19K-02        ctgtggagagcggtggtgagacacaagaatcgcctgctactgttgtcttc
                         ********** ** *************** *  *  **********  *

A0A7L4WIC2_E1B19K-      cgtccgcccggcaataataccgacggagc---------------agcagc
A0A0G2R248_E1B19K-      cgtccgcccggcgataataccgacggagg---------------------
A0A7D0TN91_E1B19K-      cgtccgcccggcaataataccgacggagg------------------agc
A0A7L4WK62_E1B19K-      cgtccgcccggcaataatacggacggagg---------------------
A0A291P1B2_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
T1UG63_E1B19K-01        cgtccgcccggcaataataccgacggagg------------------agc
A0A3S9SND6_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A3S9SNH4_E1B19K-      cgtccgcccggcaataataccgacggagg------------------agc
A0A3Q9HJZ5_E1B19K-      cgtccgcccggcaataataccgacggagg---------------agcagc
A0A3S9SP19_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A6M4W5T4_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A7L4WG90_E1B19K-      cgtccgcccggcaataataccgacggagg---------agcagcagcagc
J9Z4H6_E1B19K-01        cgtccgcccggcaataataccgacggaag---------------agcagc
J9Z5H0_E1B19K-01        cgtccgcccggcaataataccgacggagg---------------------
A0A7L4WIG2_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A3Q9HK78_E1B19K-      cgtccgcccggcaataataccgacggagg------------------agc
A0A3Q9HK00_E1B19K-      cgtccgcccggcaataataccgacggagg---------------agcagc
A0A3Q9HJ54_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A2H4PJ75_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A3Q9HJ63_E1B19K-      cgtccgcccggcaataataccgacggagg------------agcagcagc
A0A3S9SPV1_E1B19K-      cgtccgcccggcaataataccgacggaggagcagcagcagcagcagcagc
A0A7L4WGT1_E1B19K-      cgtccgcccggcaataataccgacggagg---------------------
A0A7L4WJT1_E1B19K-      cgtccgcccggcaataataccgacggagg------agcagcagcagcagc
J7I6T8_E1B19K-01        cgtccgcccggcaataataccgacggagg---------------------
A0A3S9SSS2_E1B19K-      cgtccgcccggc---aataccgacggagg------------------agc
E1ARN8_E1B19K-01        cgtccgcccggcaataataccgacggagg------------------agc
J9Z4N4_E1B19K-01        cgtccgcccggcaataataccgacggagg------------------agc
A0A3Q9HLF7_E1B19K-      cgtcagcccggcaataataccgacggagg------------------agc
A0A3S9SNY0_E1B19K-      cgtcagcccggcaataataccgacggagg------------------agc
A0A7D0TLU2_E1B19K-      cgtccaccttgcaataataccgacgttat---------------------
A0A0G2R248_E1B19K-      cgtccgcccggcgataataccgacggagg---------------------
J9Z5H0_E1B19K-02        cgtccgcccggcaataataccgacggagg---------------------
J9Z4N4_E1B19K-02        cgtccgcccggcaataataccgacggagg---------------------
E1ARN8_E1B19K-03        cgtccgcccggcaataataccgacggagg---------------------
E1ARN8_E1B19K-02        cgtccgcccggcaataataccgacggagg---------------------
E1ARN8_E1B19K-04        cgtccgcccggcaataataccgacggagg---------------------
T1UG63_E1B19K-02        cgtccgcccggcaataataccgacggagg---------------------
J7I6T8_E1B19K-02        cgtccgcccggcaataataccgacggagg---------------------
J9Z4H6_E1B19K-02        cgtccgcccggcaataataccgacggaag------------------agc
                        ****  **  **   ***** ****                         

A0A7L4WIC2_E1B19K-      agcagcagcagcagcagcagcagcaggaggaagcca---ggcggcggcgg
A0A0G2R248_E1B19K-      ------agcag---cagcagcagcaggaggaagcca------ggcggcgg
A0A7D0TN91_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A7L4WK62_E1B19K-      ---agcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A291P1B2_E1B19K-      ---------------agcaacagcaggaggaagcca---ggcggcggcgg
T1UG63_E1B19K-01        agcagcagcag---cagcagcagcaggaggaagccaggcggcggcggcgg
A0A3S9SND6_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3S9SNH4_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HJZ5_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3S9SP19_E1B19K-      ---------------agcaacagcaggaggaagcca---ggcggcggcgg
A0A6M4W5T4_E1B19K-      agcagcagcag---cagcagcagcaggaggaaacca---ggcggcggcgg
A0A7L4WG90_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---gacggcggcgg
J9Z4H6_E1B19K-01        agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
J9Z5H0_E1B19K-01        ---------------agcaacagcaggaggaagcca---ggcggcggcgg
A0A7L4WIG2_E1B19K-      agcagcagcag---cagcagctgcaggaggaagcca---ggcggcggcgg
A0A3Q9HK78_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HK00_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HJ54_E1B19K-      ---------------agcaacagcaggaggaagccaggcggcggcggcgg
A0A2H4PJ75_E1B19K-      ---agcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HJ63_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3S9SPV1_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A7L4WGT1_E1B19K-      ---------------------------aggaagcca---ggcggcggcgg
A0A7L4WJT1_E1B19K-      agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
J7I6T8_E1B19K-01        agcagcagcag---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3S9SSS2_E1B19K-      agcagcagcaacagcagcagcagcaggaggaagcca---ggcggcggcgg
E1ARN8_E1B19K-01        agcagcagcaa---cagcagcagcaggaggaagcca---ggcggcggcgg
J9Z4N4_E1B19K-01        ag------------cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3Q9HLF7_E1B19K-      agcagcagcaa---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A3S9SNY0_E1B19K-      agcagcagcaa---cagcagcagcaggaggaagcca---ggcggcggcgg
A0A7D0TLU2_E1B19K-      ---------------ggcctcctcaaaatcacccct---ggctgcgccgg
A0A0G2R248_E1B19K-      ---------agcagcagcagcagcaggaggaagcca------ggcggcgg
J9Z5H0_E1B19K-02        ---------------agcaacagcaggaggaagcca---ggcggcggcgg
J9Z4N4_E1B19K-02        agcag---------cagcagcagcaggaggaagcca---ggcggcggcgg
E1ARN8_E1B19K-03        agcagcagcagcaacagcagcagcaggaggaagcca---ggcggcggcgg
E1ARN8_E1B19K-02        agcagcagcagcaacagcagcagcaggaggaagcca---ggcggcggcgg
E1ARN8_E1B19K-04        agcagcagcagcaacagcagcagcaggaggaagcca---ggcggcggcgg
T1UG63_E1B19K-02        agcagcagcagcagcagcagcagcaggaggaagccaggcggcggcggcgg
J7I6T8_E1B19K-02        ---agcagcagcagcagcagcagcaggaggaagcca---ggcggcggcgg
J9Z4H6_E1B19K-02        agcagcagcagcagcagcagcagcaggaggaagcca---ggcggcggcgg
                                                   *  *  **        *** ***

A0A7L4WIC2_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A0G2R248_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A7D0TN91_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A7L4WK62_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A291P1B2_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
T1UG63_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SND6_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SNH4_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HJZ5_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SP19_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A6M4W5T4_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A7L4WG90_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J9Z4H6_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J9Z5H0_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A7L4WIG2_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HK78_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HK00_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HJ54_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A2H4PJ75_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HJ63_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SPV1_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A7L4WGT1_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A7L4WJT1_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J7I6T8_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SSS2_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
E1ARN8_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J9Z4N4_E1B19K-01        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3Q9HLF7_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A3S9SNY0_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
A0A7D0TLU2_E1B19K-      ggggaggagcagagcttattgtacttgcaatctggcctggaccctcggaa
A0A0G2R248_E1B19K-      cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J9Z5H0_E1B19K-02        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J9Z4N4_E1B19K-02        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
E1ARN8_E1B19K-03        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
E1ARN8_E1B19K-02        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
E1ARN8_E1B19K-04        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
T1UG63_E1B19K-02        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J7I6T8_E1B19K-02        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
J9Z4H6_E1B19K-02        cggcaggagcagagcccatggaacccgagagccggcctggaccctcggga
                         ** ***********  ** * **  *  * * *************** *

A0A7L4WIC2_E1B19K-      atg-----------------------------------------------
A0A0G2R248_E1B19K-      atg-----------------------------------------------
A0A7D0TN91_E1B19K-      atg-----------------------------------------------
A0A7L4WK62_E1B19K-      atg-----------------------------------------------
A0A291P1B2_E1B19K-      atg-----------------------------------------------
T1UG63_E1B19K-01        atg-----------------------------------------------
A0A3S9SND6_E1B19K-      atg-----------------------------------------------
A0A3S9SNH4_E1B19K-      atg-----------------------------------------------
A0A3Q9HJZ5_E1B19K-      atg-----------------------------------------------
A0A3S9SP19_E1B19K-      atg-----------------------------------------------
A0A6M4W5T4_E1B19K-      atg-----------------------------------------------
A0A7L4WG90_E1B19K-      atg-----------------------------------------------
J9Z4H6_E1B19K-01        atg-----------------------------------------------
J9Z5H0_E1B19K-01        atg-----------------------------------------------
A0A7L4WIG2_E1B19K-      atg-----------------------------------------------
A0A3Q9HK78_E1B19K-      atg-----------------------------------------------
A0A3Q9HK00_E1B19K-      atg-----------------------------------------------
A0A3Q9HJ54_E1B19K-      atg-----------------------------------------------
A0A2H4PJ75_E1B19K-      atg-----------------------------------------------
A0A3Q9HJ63_E1B19K-      atg-----------------------------------------------
A0A3S9SPV1_E1B19K-      atg-----------------------------------------------
A0A7L4WGT1_E1B19K-      atg-----------------------------------------------
A0A7L4WJT1_E1B19K-      atg-----------------------------------------------
J7I6T8_E1B19K-01        atg-----------------------------------------------
A0A3S9SSS2_E1B19K-      atg-----------------------------------------------
E1ARN8_E1B19K-01        atg-----------------------------------------------
J9Z4N4_E1B19K-01        atg-----------------------------------------------
A0A3Q9HLF7_E1B19K-      atg-----------------------------------------------
A0A3S9SNY0_E1B19K-      atg-----------------------------------------------
A0A7D0TLU2_E1B19K-      gtgccaccttgtgcatataccccaatggcctccagaactgagacgcattt
A0A0G2R248_E1B19K-      atg-aatgttgtacaggtggctgaactgtatccagaactgagacgcattt
J9Z5H0_E1B19K-02        atg-aatgttgtacaggtggctgaactgtttccagaactgagacgcattt
J9Z4N4_E1B19K-02        atg-aatgttgtacaggtggctgaactgtttccagaactgagacgcattt
E1ARN8_E1B19K-03        atg-aatgttgt--------------------------------------
E1ARN8_E1B19K-02        atg-aatgttgtacaggtggctgaactgtttccagaactgagacgcattt
E1ARN8_E1B19K-04        atg-aatgttgt--------------------------------------
T1UG63_E1B19K-02        atg-aatgttgtacaggtggctgaactgtttccagaactgagacgcattt
J7I6T8_E1B19K-02        atg-aatgttgtacaggtggctgaactgtttccagaactgagacgcattt
J9Z4H6_E1B19K-02        atg-aatgttgtacaggtggctgaactgtttccagaactgagacgcattt
                         **                                               

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      taaccattaacgaggatgggcaggggctaaagggggtaaagagggagcgg
A0A0G2R248_E1B19K-      tgacaattacagaggatgggcaggggctaaagggggtaaagagggagcgg
J9Z5H0_E1B19K-02        taaccattaacgaggatgggcaggggctaaagggggtaaagagggagcgg
J9Z4N4_E1B19K-02        taaccattaacgaggatgggcaggggctaaagggggtaaagagggagcgg
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        taaccattaacgaggatgggcaggggctaaagggggtaaagagggagcgg
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        taaccattaacgaggatgggcaggggctaaagggggtaaagagggagcgg
J7I6T8_E1B19K-02        taaccattaacgaggatgggcaggggctaaagggggtaaagagggagcgg
J9Z4H6_E1B19K-02        taaccattaacgaggatgggcaggggctaaagggggtaaagagggagcgg
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      ggggcttctgaggctacagaggaggttaggaatttaacttttagcttcaa
A0A0G2R248_E1B19K-      ggggcttgtgaggctacagaggaggctaggaatctagcttttagcttaat
J9Z5H0_E1B19K-02        ggggcttctgaggctacagaggaggctaggaatctaacttttagcttaat
J9Z4N4_E1B19K-02        ggggcttctgaggctacagaggaggttaggaatttaacttttagcttaat
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        ggggcttctgaggctacagaggaggttaggaatttaacttttagcttaat
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        ggggcttctgaggctacagaggaggttaggaatctaacttttagcttaat
J7I6T8_E1B19K-02        ggggcttctgaggctacagaggaggttaggaatctaacttttagcttaat
J9Z4H6_E1B19K-02        ggggcttctgaggctacagaggaggttaggaatctaacttttagcttaat
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      aatcagtcccctggctgagccagtaagtggtcagcagattaaggataatt
A0A0G2R248_E1B19K-      gaccagacaccgtcctgagtgtattacttttcaacagatcaaggataatt
J9Z5H0_E1B19K-02        gaccagacaccgtcctgagtgtgttacttttcagcagattaaggataatt
J9Z4N4_E1B19K-02        gaccagacaccgtcctgagtgtgttacttttcagcagattaaggataatt
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        gaccagacaccgtcctgagtgtgttacttttcagcagattaaggataatt
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        gaccagacaccgtcctgagtgtgttacttttcagcagattaaggataatt
J7I6T8_E1B19K-02        gaccagacaccgtcctgagtgtgttacttttcagcagattaaggataatt
J9Z4H6_E1B19K-02        gaccagacaccgtcctgagtgtgttacttttcagcagattaaggataatt
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      gcgctaatgagcttgatctgctggcgcagaagtattccatagagcagctg
A0A0G2R248_E1B19K-      gcgctaatgagcttgatctgctggcgcagaagtattccatagagcagctg
J9Z5H0_E1B19K-02        gcgctaatgagcttgatctgctggcgcagaagtattccatagagcagctg
J9Z4N4_E1B19K-02        gcgctaatgagcttgatctgctggcgcagaagtattccatagagcagctg
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        gcgctaatgagcttgatctgctggcgcagaagtattccatagagcagctg
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        gcgctaatgagcttgatctgctggcgcagaagtattctatagagcagctg
J7I6T8_E1B19K-02        gcgctaatgagcttgatctgctggcgcagaagtattccatagagcagctg
J9Z4H6_E1B19K-02        gcgctaatgagcttgatctgctggcgcagaagtattccatagagcagctg
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      accacttactggctgcagccaggggatgattttgaggaggctattagggt
A0A0G2R248_E1B19K-      accacttactggctgcagccaggggatgattttgaggaggctattagggt
J9Z5H0_E1B19K-02        accacttactggctgcagccaggggatgattttgaggaggctattagggt
J9Z4N4_E1B19K-02        accacttactggctgcagccaggggatgattttgaggaggctattagggt
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        accacttactggctgcagccaggggatgattttgaggaggctattagggt
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        accacttactggctgcagccaggggatgattttgaggaggctattagggt
J7I6T8_E1B19K-02        accacttactggctgcagccaggggatgattttgaggaggctattagggt
J9Z4H6_E1B19K-02        accacttactggctgcagccaggggatgattttgaggaggctattagggt
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      atatgcaaaggtggcacttaggccagattgcaagtacaagattagcaaac
A0A0G2R248_E1B19K-      atatgcaaaggtggcacttaggccagattgcaagtacaagatcagcaaac
J9Z5H0_E1B19K-02        atatgcaaaggtggcacttaggccagattgcaagtacaagattagcaaac
J9Z4N4_E1B19K-02        atatgcaaaggtggcacttaggccagattgcaagtacaagattagcaaac
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        atatgcaaaggtggcacttaggccagattgcaagtacaagattagcaaac
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        atatgcaaaggtggcacttaggccagattgtaagtacaagattagcaaac
J7I6T8_E1B19K-02        atatgcaaaggtggcacttaggccagattgcaagtacaagattagcaaac
J9Z4H6_E1B19K-02        atatgcaaaggtggcacttaggccagattgcaagtacaagattagcaaac
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      ttgtaaatatcaggaattgttgctacatttctgggaacggggccgaggtg
A0A0G2R248_E1B19K-      ttgtaaatatcaggaattgttgctacatttctgggaacggggccgaggtg
J9Z5H0_E1B19K-02        ttgtaaatatcaggaattgttgctacatttctgggaacggggccgaggtg
J9Z4N4_E1B19K-02        ttgtaaatatcaggaattgttgctacatttctgggaacggggccgaggtg
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        ttgtaaatatcaggaattgttgctacatttctgggaacggggccgaggtg
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        ttgtaaatatcaggaattgttgctacatttctgggaacggggccgaggtg
J7I6T8_E1B19K-02        ttgtaaatattaggaattgttgctacatttctgggaacggggccgaggtg
J9Z4H6_E1B19K-02        ttgtaaatatcaggaattgttgctacatttctgggaacggggccgaggtg
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      gagatagatacggaggatagggtggcctttagatgtagcatgataaatat
A0A0G2R248_E1B19K-      gagatagatacggaggatagggtggcctttagatgtagcatgataaatat
J9Z5H0_E1B19K-02        gagatagatacggaggatagggtggcctttagatgtagcatgataaatat
J9Z4N4_E1B19K-02        gagatagatacggaggatagggtggcctttagatgtagcatgataaatat
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        gagatagatacggaggatagggtggcctttagatgtagcatgataaatat
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        gagatagatacggaggatagggtggcctttagatgtagcatgataaatat
J7I6T8_E1B19K-02        gagatagatacggaggatagggtggcctttagatgtagcatgataaatat
J9Z4H6_E1B19K-02        gagatagatacggaggatagggtggcctttagatgtagcatgataaatat
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      gtggccgggggtacttggcatggacggggtggttattatgaatgtgaggt
A0A0G2R248_E1B19K-      gtggccgggggtgcttggcatggacggggtggttattatgaatgtaaggt
J9Z5H0_E1B19K-02        gtggccgggggtgcttggcatggacggggtggttattatgaatgtgaggt
J9Z4N4_E1B19K-02        gtggccgggggtacttggcatggacggggtggttattatgaatgtgaggt
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        gtggccgggggtacttggcatggacggggtggttattatgaatgtgaggt
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        gtggccgggggtgcttggcatggacggggtggttattatgaatgtgaggt
J7I6T8_E1B19K-02        gtggccgggggtgcttggcatggacggggtggttattatgaatgtgaggt
J9Z4H6_E1B19K-02        gtggccgggggtgcttggcatggacggggtggttattatgaatgtgaggt
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      ttactggccccaattttagcggtacggttttcctggccaataccaacctt
A0A0G2R248_E1B19K-      ttactggccccaattttagcggtacggttttcctggccaataccaacctt
J9Z5H0_E1B19K-02        ttactggtcccaattttagcggtacggttttcctggctaataccaatctt
J9Z4N4_E1B19K-02        ttactggcccaaattttagcggtacggttttcctggccaataccaacctt
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        ttactggccccaattttagcggtacggttttcctggccaataccaacctt
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        ttactggtcccaattttagcggtacggttttcctggccaataccaacctt
J7I6T8_E1B19K-02        ttactggccccaattttagcggtacggtttttctggccaataccaacctt
J9Z4H6_E1B19K-02        ttactggccccaattttagcggtacggtttttctggccaataccaacctt
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      atcctacacggtccaggcttccacaggtttgttaatacctgcatagaagc
A0A0G2R248_E1B19K-      atcctacacggtgtaagcttctatgggtttaacaatacctgtgtggaagc
J9Z5H0_E1B19K-02        atcctacacggtgtaagcttctatgggtttaacaatacctgtgtggaagc
J9Z4N4_E1B19K-02        atcctacacggtgtaagcttctatgggtttaacaatacctgcgtggaagc
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        atcctacacggtgtaagcttctatgggtttaacaatacctgcgtggaagc
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        atcctacacggtgtaagcttctatgggtttaacaatacctgcgtggaagc
J7I6T8_E1B19K-02        atcctacacggtgtaagcttctatgggttcaacaatacctgcgtggaagc
J9Z4H6_E1B19K-02        atcctacacggtgtaagcttctatgggtttaacaatacctgcgtggaagc
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      ttggaccgatgtaagggttcggggctgtgccttttactgctgctggaagg
A0A0G2R248_E1B19K-      ctggaccgatgtaagggttcggggctgtgccttttactgctgctggaagg
J9Z5H0_E1B19K-02        ctggaccgatgtaagggttcgtggctgtgccttttactgctgctggaagg
J9Z4N4_E1B19K-02        ctggaccgatgtaagggttcgaggctgtgccttttactgctgctggaagg
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        ctggaccgatgtaagggttcgaggctgtgccttttactgctgctggaagg
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        ctggaccgatgtaagggttcggggctgtgccttttactgctgctggaagg
J7I6T8_E1B19K-02        ctggaccgatgtaagggttcggggctgtgccttttactgctgctggaagg
J9Z4H6_E1B19K-02        ctggaccgatgtaagggttcggggctgtgccttttactgctgctggaagg
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      gggtggtgtgtcgccccaaaagcagggcttcaattaagaaatgcctcttt
A0A0G2R248_E1B19K-      gggtggtgtgtcgccccaaaagcagggcttcaattaagaaatgcctcttt
J9Z5H0_E1B19K-02        gggtggtgtgtcgccccaaaagcagggcttcaattaagaaatgcctcttt
J9Z4N4_E1B19K-02        gggtggtgtgtcgccccaaaagcagggcttcaattaagaaatgcctcttt
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        gggtggtgtgtcgccccaaaagcagggcttcaattaagaaatgcctcttt
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        gggtggtgtgtcgccccaaaagcagggcttcaattaagaaatgccttttt
J7I6T8_E1B19K-02        gggtggtatgtcgccccaaaagcagggcttcaattaagaaatgccttttt
J9Z4H6_E1B19K-02        gggtggtgtgtcgtcccaaaagcagggcttcaattaagaaatgccttttt
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      gaaaggtgtaccttgggtatcctgtctgagggtaactccagggtgcgcca
A0A0G2R248_E1B19K-      gaaaggtgtaccttgggtatcctgtctgagggtaactccagggtgcgcca
J9Z5H0_E1B19K-02        gaaaggtgtaccttgggtatcctgtctgagggtaactccagggtgcgcca
J9Z4N4_E1B19K-02        gaaaggtgtaccttgggtatcctgtctgagggtaactccagggtgcgcca
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        gaaaggtgtaccttgggtatcctgtctgagggtaactccagggtgcgcca
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        gaaaggtgtaccttgggtatcctgtctgagggtaactccagggtgcgcca
J7I6T8_E1B19K-02        gaaaggtgtaccttgggtatcctgtctgagggtaactccagggtgcgcca
J9Z4H6_E1B19K-02        gaaaggtgtaccttgggtatcctgtctgagggtaactccagggtgcgcca
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      caatgtggcctccgactgtggttgcttcatgctagtgaaaagcgtggctg
A0A0G2R248_E1B19K-      caatgtggcctccgactgtggttgcttcatgctagtgaaaagcgtggctg
J9Z5H0_E1B19K-02        caatgtggcctccgactgtggttgcttcatgctagtgaaaagcgtggctg
J9Z4N4_E1B19K-02        caatgtggcctccgactgtggttgcttcatgctagtgaaaagcgtggctg
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        caatgtggcctccgactgtggttgcttcatgctagtgaaaagcgtggctg
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        caatgtggcctccgactgtggttgcttcatgctagtgaaaagcgtggctg
J7I6T8_E1B19K-02        caatgtggcctccgactgtggctgcttcatgctagtgaaaagcgtggctg
J9Z4H6_E1B19K-02        caatgtggcctccgactgtggttgcttcatgctagtgaaaagcgtggctg
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      tgattaagcataacatggtgtgtggcaactgcgaggccctgtcctcgcag
A0A0G2R248_E1B19K-      tgattaagcataacatggtatgtggcaactgcgaggacagggcctctcag
J9Z5H0_E1B19K-02        tgattaagcataacatggtgtgtggcaactgcgaggacagggcctctcag
J9Z4N4_E1B19K-02        tgattaagcataacatggtgtgtggcaactgcgaggacagggcctctcag
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        tgattaagcataacatggtgtgtggcaactgcgaggacagggcctctcag
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        tgattaagcataacatggtgtgtggcaactgcgaggacagggcctctcag
J7I6T8_E1B19K-02        tgattaagcataacatggtgtgtggcaactgcgaggacagggcctctcag
J9Z4H6_E1B19K-02        tgattaagcataacatggtgtgtggcaactgcgaggacagggcctctcag
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      ttgccaaccaccatgttatgcattaatcacagcctgaagatcattcacgt
A0A0G2R248_E1B19K-      atgctgacctgctcggacggcaactgtcacctgctgaagaccattcacgt
J9Z5H0_E1B19K-02        atgctgacctgctcggacggcaactgtcacttgctgaagaccattcacgt
J9Z4N4_E1B19K-02        atgctaacctgctcggacggcaactgtcacctgctgaagaccattcacgt
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        atgctaacctgctcggacggcaactgtcacctgctgaagaccattcacgt
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        atgctaacctgctcggatggcaactgtcacctgctgaagaccattcacgt
J7I6T8_E1B19K-02        atgctgacctgctcggacggcaactgtcacctgctgaagaccattcacgt
J9Z4H6_E1B19K-02        atgctgacctgctcggacggcaactgtcacctgctgaagaccattcacgt
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      agccagccactctcgcaaggcctggccagtgtttgagcacaacatactga
A0A0G2R248_E1B19K-      agccagccactctcgcaaggcctggccagtgtttgagcataacatactga
J9Z5H0_E1B19K-02        agccagccactctcgcaaggcctggccagtgtttgagcacaacatactga
J9Z4N4_E1B19K-02        agccagccactctcgcaaggcctggccagtgtttgagcacaacatactaa
E1ARN8_E1B19K-03        --------------------------------------------------
E1ARN8_E1B19K-02        agccagccactctcgcaaggcctggccagtgtttgagcacaacatactga
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        agccagtcactctcgcaaggcctggccagtgtttgagcacaacatactga
J7I6T8_E1B19K-02        agccagccactctcgcaaggcctggccagtgtttgagcacaacatactga
J9Z4H6_E1B19K-02        agccagccactctcgcaaggcctggccagtgtttgagcacaacatactga
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      cccgctgttccttgcatttgggtaacaggaggggggtgttcctaccttac
A0A0G2R248_E1B19K-      cccgctgttccttgcatttgggtaacaggaggggggtgttcctaccttac
J9Z5H0_E1B19K-02        cccgctgttccttgcatttgggtaacaggaggggggtgttcctaccttac
J9Z4N4_E1B19K-02        cccgctgttccttgcatttgggtaacaggaggggggtgttcctaccttac
E1ARN8_E1B19K-03        ------------------------acag----------------------
E1ARN8_E1B19K-02        cccgctgttccttgcatttgggtaacaggaggggggtgttcctaccttac
E1ARN8_E1B19K-04        ------------------------acaggaggggggtgttcctaccttac
T1UG63_E1B19K-02        cacgctgttccttgcatttgggtaacaggaggggggtgttcctaccttac
J7I6T8_E1B19K-02        cccgctgttccttgcatttgggtaataggaggggggtgttcctaccttac
J9Z4H6_E1B19K-02        cccgctgttccttgcatttgggtaacaggaggggggtgttcctaccttac
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      caatgcaatttgagtcacactaagatattgcttgagcccatggtcatgtc
A0A0G2R248_E1B19K-      caatgcaatttgagtcacactaagatattgcttgagcccgagagcatgtc
J9Z5H0_E1B19K-02        caatgcaatttgagtcacactaagatattgcttgagcccgagagcatgtc
J9Z4N4_E1B19K-02        caatgcaatttgagtcacactaagatattgcttgagcccgaaagcatgtc
E1ARN8_E1B19K-03        ------------------------------------cccgaaagcatgtc
E1ARN8_E1B19K-02        caatgcaatttgagtcacactaagatattgcttgagcccgaaagcatgtc
E1ARN8_E1B19K-04        caatgcaatttgagtcacactaa---------------------------
T1UG63_E1B19K-02        caatgcaatttgagtcacactaagatattgcttgagcccgagagcatgtc
J7I6T8_E1B19K-02        caatgcaatttgagtcacactaagatattgcttgagcccgagagcatgtc
J9Z4H6_E1B19K-02        caatgcaatttgagtcacactaagatattgcttgagcccgagagcatgtc
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      caaggtgaacctgaacggggtgtttgacatgaccatgaagatctggaagg
A0A0G2R248_E1B19K-      caaggtgaacctgaacggggtgtttgacatgaccatgaagatctggaagg
J9Z5H0_E1B19K-02        caaggtgaacctgaacggggtgtttgacatgaccatgaagatctggaagg
J9Z4N4_E1B19K-02        caaggtgaacctgaacggggtgtttgacatgaccatgaagatctggaagg
E1ARN8_E1B19K-03        caaggtgaacctgaacggggtgtttgacatgaccatgaagatctggaagg
E1ARN8_E1B19K-02        caaggtgaacctgaacggggtgtttgacatgaccatgaagatctggaagg
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        caaggtgaacctgaacggggtgtttgacatgaccatgaagatctggaagg
J7I6T8_E1B19K-02        caaggtgaacctgaacggggtgtttgacatgaccatgaagatctggaagg
J9Z4H6_E1B19K-02        caaggtgaacctgaacggggtgtttgacatgaccatgaagatctggaagg
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      tgctgaggtacgatgagacccgcaccaggtgcagaccctgcgagtgtggc
A0A0G2R248_E1B19K-      tgctgaggtacgatgagacccgcaccaggtgcagaccctgcgagtgtggc
J9Z5H0_E1B19K-02        tgctgaggtacgatgagacccgcaccaggtgcagaccctgcgagtgtggc
J9Z4N4_E1B19K-02        tgctgaggtacgatgagacccgcaccaggtgcagaccctgcgagtgtggc
E1ARN8_E1B19K-03        tgctgaggtacgatgagacccgcaccaggtgcagaccctgcgagtgtggc
E1ARN8_E1B19K-02        tgctgaggtacgatgagacccgcaccaggtgcagaccctgcgagtgtggc
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        tgctgaggtacgatgagacccgcaccaggtgcagaccctgcgagtgtggc
J7I6T8_E1B19K-02        tgctgaggtacgatgagacccgcaccaggtgcagaccctgcgaatgtggc
J9Z4H6_E1B19K-02        tgctgaggtacgatgagacccgcaccagatgcagaccctgcgagtgtggc
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      ggtaaacatattaggaaccagcctgtgatgctggatgtgaccgaggagct
A0A0G2R248_E1B19K-      ggtaaacatattaggaaccagcctgtgatgctggatgtgaccgaggagct
J9Z5H0_E1B19K-02        ggtaaacatattaggaaccagcctgtgatgctggatgtgaccgaggagct
J9Z4N4_E1B19K-02        ggtaaacatattaggaaccagcctgtgatgctggatgtgaccgaggagct
E1ARN8_E1B19K-03        ggtaaacatattaggaaccagcctgtgatgctggatgtgaccgaggagct
E1ARN8_E1B19K-02        ggtaaacatattaggaaccagcctgtgatgctggatgtgaccgaggagct
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        ggtaaacatattaggaaccagcctgtgatgctggatgtgaccgaggagct
J7I6T8_E1B19K-02        ggtaaacatattaggaaccagcctgtgatgctggatgtgaccgaggagct
J9Z4H6_E1B19K-02        ggtaaacatattaggaaccagcctgtgatgctggatgtgaccgaggagct
                                                                          

A0A7L4WIC2_E1B19K-      --------------------------------------------------
A0A0G2R248_E1B19K-      --------------------------------------------------
A0A7D0TN91_E1B19K-      --------------------------------------------------
A0A7L4WK62_E1B19K-      --------------------------------------------------
A0A291P1B2_E1B19K-      --------------------------------------------------
T1UG63_E1B19K-01        --------------------------------------------------
A0A3S9SND6_E1B19K-      --------------------------------------------------
A0A3S9SNH4_E1B19K-      --------------------------------------------------
A0A3Q9HJZ5_E1B19K-      --------------------------------------------------
A0A3S9SP19_E1B19K-      --------------------------------------------------
A0A6M4W5T4_E1B19K-      --------------------------------------------------
A0A7L4WG90_E1B19K-      --------------------------------------------------
J9Z4H6_E1B19K-01        --------------------------------------------------
J9Z5H0_E1B19K-01        --------------------------------------------------
A0A7L4WIG2_E1B19K-      --------------------------------------------------
A0A3Q9HK78_E1B19K-      --------------------------------------------------
A0A3Q9HK00_E1B19K-      --------------------------------------------------
A0A3Q9HJ54_E1B19K-      --------------------------------------------------
A0A2H4PJ75_E1B19K-      --------------------------------------------------
A0A3Q9HJ63_E1B19K-      --------------------------------------------------
A0A3S9SPV1_E1B19K-      --------------------------------------------------
A0A7L4WGT1_E1B19K-      --------------------------------------------------
A0A7L4WJT1_E1B19K-      --------------------------------------------------
J7I6T8_E1B19K-01        --------------------------------------------------
A0A3S9SSS2_E1B19K-      --------------------------------------------------
E1ARN8_E1B19K-01        --------------------------------------------------
J9Z4N4_E1B19K-01        --------------------------------------------------
A0A3Q9HLF7_E1B19K-      --------------------------------------------------
A0A3S9SNY0_E1B19K-      --------------------------------------------------
A0A7D0TLU2_E1B19K-      gaggcccgatcacttggtgctggcctgcacccgcgctgagtttggctcta
A0A0G2R248_E1B19K-      gaggcccgatcacttggtgctggcctgcacccgcgctgagtttggctcta
J9Z5H0_E1B19K-02        gaggcccgatcacttggtgctggcctgcacccgcgctgagtttggctcta
J9Z4N4_E1B19K-02        gaggcccgatcacttggtgctggcctgcacccgcgctgagtttggctcta
E1ARN8_E1B19K-03        gaggcccgatcacttggtgctggcctgcacccgcgctgagtttggctcta
E1ARN8_E1B19K-02        gaggcccgatcacttggtgctggcctgcacccgcgctgagtttggctcta
E1ARN8_E1B19K-04        --------------------------------------------------
T1UG63_E1B19K-02        gaggcccgatcacttggtgctggcctgcacccgcgctgagtttggctcta
J7I6T8_E1B19K-02        gaggcccgatcacttggtgctggcctgcacccgcgctgagtttggctcta
J9Z4H6_E1B19K-02        gaggcccgatcacttggtgctggcctgcacccgcgctgagtttggctcta
                                                                          

A0A7L4WIC2_E1B19K-      -------------------a
A0A0G2R248_E1B19K-      -------------------a
A0A7D0TN91_E1B19K-      -------------------a
A0A7L4WK62_E1B19K-      -------------------a
A0A291P1B2_E1B19K-      -------------------a
T1UG63_E1B19K-01        -------------------a
A0A3S9SND6_E1B19K-      -------------------a
A0A3S9SNH4_E1B19K-      -------------------a
A0A3Q9HJZ5_E1B19K-      -------------------a
A0A3S9SP19_E1B19K-      -------------------a
A0A6M4W5T4_E1B19K-      -------------------a
A0A7L4WG90_E1B19K-      -------------------a
J9Z4H6_E1B19K-01        -------------------a
J9Z5H0_E1B19K-01        -------------------a
A0A7L4WIG2_E1B19K-      -------------------a
A0A3Q9HK78_E1B19K-      -------------------a
A0A3Q9HK00_E1B19K-      -------------------a
A0A3Q9HJ54_E1B19K-      -------------------a
A0A2H4PJ75_E1B19K-      -------------------a
A0A3Q9HJ63_E1B19K-      -------------------a
A0A3S9SPV1_E1B19K-      -------------------a
A0A7L4WGT1_E1B19K-      -------------------a
A0A7L4WJT1_E1B19K-      -------------------a
J7I6T8_E1B19K-01        -------------------a
A0A3S9SSS2_E1B19K-      -------------------a
E1ARN8_E1B19K-01        -------------------a
J9Z4N4_E1B19K-01        -------------------a
A0A3Q9HLF7_E1B19K-      -------------------a
A0A3S9SNY0_E1B19K-      -------------------a
A0A7D0TLU2_E1B19K-      gcgatgaagatacagattga
A0A0G2R248_E1B19K-      gcgatgaagatacagattga
J9Z5H0_E1B19K-02        gcgatgaagatacagattga
J9Z4N4_E1B19K-02        gcgatgaagatacagattga
E1ARN8_E1B19K-03        gcgatgaagatacagattga
E1ARN8_E1B19K-02        gcgatgaagatacagattga
E1ARN8_E1B19K-04        --------------------
T1UG63_E1B19K-02        gcgatgaagatacagattga
J7I6T8_E1B19K-02        gcgatgaagatacagattga
J9Z4H6_E1B19K-02        gcgatgaagatacagattga
                                            

© 1998-2022Legal notice