Dataset for CDS E1B19K of organism Human mastadenovirus B

[Download (right click)] [Edit] [Sequences] [Repertoires]

31 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


T2CI10_E1B19K-02        atggatcccacagacccacttcagcaagggatacgttttggatttcatag
T1UIP3_E1B19K-02        atggatccgccaaacccacttcagcaagggatacgttttggatttcatag
J7I6Q4_E1B19K-02        atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
J7I6S4_E1B19K-02        atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
J7ID56_E1B19K-02        atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
T1UF50_E1B19K-02        atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
I6LEP5_E1B19K-02        atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
I6LES1_E1B19K-03        --------------------------------------------------
T2CI10_E1B19K-01        atgga---------------------------------------------
A0A0K0PX35_E1B19K-      atgga---------------------------------------------
A0A0K0PX99_E1B19K-      atgga---------------------------------------------
T1UIP3_E1B19K-01        atgga---------------------------------------------
J7I6Q4_E1B19K-01        atgga---------------------------------------------
J7I6S4_E1B19K-01        atgga---------------------------------------------
J7ID56_E1B19K-01        atgga---------------------------------------------
I6LEP5_E1B19K-01        atgga---------------------------------------------
A0A6M6AA96_E1B19K-      atgga---------------------------------------------
I6LES1_E1B19K-01        atgga---------------------------------------------
T1UF50_E1B19K-01        atgaa---------------------------------------------
J7I6W7_E1B19K-02        atggatcccgcagactcatttcagcaggggatacgttttggatttcgtag
T1UFS4_E1B19K-02        atggatcccgcagactcatttcagcaggggatacgttttggatttcgtag
T1UE63_E1B19K-02        atggatcccgcagactcatttcagcaggggatacgttttggatttcatag
T1UJX4_E1B19K-02        atggatcccgcagactcatttcagcaggggatacgttttggatttcatag
T1UJX4_E1B19K-01        atgga-----------------------------ggtttgggc-------
Q5UW22_E1B19K-01        atgga-----------------------------ggtttgggc-------
T1UE63_E1B19K-01        atgga-----------------------------ggtttgggc-------
J7I6W7_E1B19K-01        atgga-----------------------------ggtttgggc-------
A0A1L7NRH1_E1B19K-      atgga-----------------------------ggtttgggc-------
T1UFS4_E1B19K-01        atgga-----------------------------ggtttgggc-------
                                                                          

T2CI10_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
T1UIP3_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
J7I6Q4_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
J7I6S4_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
J7ID56_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
T1UF50_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
I6LEP5_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
I6LES1_E1B19K-03        --------------------------------------------------
T2CI10_E1B19K-01        ----------------------------------ggtttgggccatcttg
A0A0K0PX35_E1B19K-      ----------------------------------ggtttgggctatcttg
A0A0K0PX99_E1B19K-      ----------------------------------ggtttgggctatcttg
T1UIP3_E1B19K-01        ----------------------------------ggtttgggctatcttg
J7I6Q4_E1B19K-01        ----------------------------------ggtttgggctatcttg
J7I6S4_E1B19K-01        ----------------------------------ggtttgggctatcttg
J7ID56_E1B19K-01        ----------------------------------ggtttgggctatcttg
I6LEP5_E1B19K-01        ----------------------------------ggtttgggctatcttg
A0A6M6AA96_E1B19K-      ----------------------------------ggtttgggctatcttg
I6LES1_E1B19K-01        ----------------------------------ggtttgggctatcttg
T1UF50_E1B19K-01        ----------------------------------ggtttgggctatcttg
J7I6W7_E1B19K-02        ccacagcattgtggagaacatggaaggttcgcaagatgaggacaatctta
T1UFS4_E1B19K-02        ccacagcattgtggagaacatggaaggttcgcaagatgaggacaatctta
T1UE63_E1B19K-02        ccacagcattgtggagaacatggaaggttcgcaagatgaggacaatctta
T1UJX4_E1B19K-02        ccacagcattgtggagaacatggaaggttcgcaagatgaggacaatctta
T1UJX4_E1B19K-01        ------cattttggaagacc-------ttaggaagactagg---------
Q5UW22_E1B19K-01        ------cattttggaagacc-------ttaggaagactagg---------
T1UE63_E1B19K-01        ------cattttggaagacc-------ttaggaagactagg---------
J7I6W7_E1B19K-01        ------cattttggaagacc-------ttagaaagactagg---------
A0A1L7NRH1_E1B19K-      ------cattttggaagacc-------ttagaaagactagg---------
T1UFS4_E1B19K-01        ------cattttggaagacc-------ttagaaagactagg---------
                                                                          

T2CI10_E1B19K-02        gattactggccagtacagcctctgggcgtagcagggatcctgagacaccc
T1UIP3_E1B19K-02        gattactggccagtgcagcctctgggagtagcagggatactgagacaccc
J7I6Q4_E1B19K-02        gattactggccagtgcagcctctaggagtagcagggatactgagacaccc
J7I6S4_E1B19K-02        aattactggccagtgcagcctctaggagtagcagggatactgagacaccc
J7ID56_E1B19K-02        gattactggccagtgcagcctctgggagtagcagggatactgagacaccc
T1UF50_E1B19K-02        gattactggccagtgcagcctctgggagtagcagggatactgagacaccc
I6LEP5_E1B19K-02        gattactggccagtgcagcctctgggagtagcagggatactgagacaccc
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        gattactggccagtgcagcctctgggagtagcagggatactgagacaccc
I6LES1_E1B19K-03        --------------------------------------------------
T2CI10_E1B19K-01        gaagat---------------------------------cttaggca---
A0A0K0PX35_E1B19K-      gaagac---------------------------------cttagaca---
A0A0K0PX99_E1B19K-      gaagac---------------------------------cttagaca---
T1UIP3_E1B19K-01        gaagac---------------------------------ctgagaca---
J7I6Q4_E1B19K-01        gaagac---------------------------------ctcagaca---
J7I6S4_E1B19K-01        gaagac---------------------------------ctcagaca---
J7ID56_E1B19K-01        gaagac---------------------------------ctcaaaca---
I6LEP5_E1B19K-01        gaagac---------------------------------ctcagaca---
A0A6M6AA96_E1B19K-      gaagac---------------------------------ctcagaca---
I6LES1_E1B19K-01        gaagac---------------------------------ctcagaca---
T1UF50_E1B19K-01        gaagac---------------------------------ctcagaca---
J7I6W7_E1B19K-02        ggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatcc
T1UFS4_E1B19K-02        ggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatcc
T1UE63_E1B19K-02        ggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatcc
T1UJX4_E1B19K-02        ggttactggccagtgcagcctttgggtgtagcgggaatcctgaggcatcc
T1UJX4_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
                                                                          

T2CI10_E1B19K-02        accgaccatgccagcggttttggaggaggagcaccaagaggacaatccga
T1UIP3_E1B19K-02        accggccatgccagcggttctggaggaggagcagcaggaggacaatccga
J7I6Q4_E1B19K-02        accgaccatgccagcggttctgcaggaggagcagcaggaggacaatccga
J7I6S4_E1B19K-02        accgaccatgccagcggttctgcaggaggagcagcaggaggacaatccga
J7ID56_E1B19K-02        accgaccatgccagcggttctgcaggaggagcagcaggaggacaatccga
T1UF50_E1B19K-02        accgaccatgccagcggttctgcaggaggagcagcaggaggacaatccga
I6LEP5_E1B19K-02        accgaccatgccagcggttctgcaggaggagcagcaggaggacaatccga
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        accgaccatgccagcggttctgcaggaggagcagcaggaggacaatccga
I6LES1_E1B19K-03        --------------------------------------------------
T2CI10_E1B19K-01        ---gactaggcaa------ctgctagaaaa--------------------
A0A0K0PX35_E1B19K-      ---gactaggcta------ctgctagaaaa--------------------
A0A0K0PX99_E1B19K-      ---gactaggcta------ctgctagaaaa--------------------
T1UIP3_E1B19K-01        ---gactaggcta------ctgctagaaaa--------------------
J7I6Q4_E1B19K-01        ---gactaggcta------ctgctagaaaa--------------------
J7I6S4_E1B19K-01        ---gactaggcta------ctgctagaaaa--------------------
J7ID56_E1B19K-01        ---gactaggcta------ctgctagaaaa--------------------
I6LEP5_E1B19K-01        ---gactaggcta------ctgctagaaaa--------------------
A0A6M6AA96_E1B19K-      ---gactaggcta------ctgatagaaaa--------------------
I6LES1_E1B19K-01        ---gactaggcta------ctgctagaaaa--------------------
T1UF50_E1B19K-01        ---gactaggcta------ctgctagaaaa--------------------
J7I6W7_E1B19K-02        accggtcatgccagcggttctggaggaggaacagcaagaggacaacccga
T1UFS4_E1B19K-02        accggtcatgccagcggttctggaggaggaacagcaagaggacaacccga
T1UE63_E1B19K-02        accggtcatgccagcggttctggaggaggaacagcaagaggacaacccga
T1UJX4_E1B19K-02        acctgtcatgccagcggttctggaggaggaacagcaagaggacaatccga
T1UJX4_E1B19K-01        -----------caactgtt-----------------ggagaacgcttcg-
Q5UW22_E1B19K-01        -----------caactgtt-----------------agagaacgcttcg-
T1UE63_E1B19K-01        -----------caactgtt-----------------agagagcgcttcg-
J7I6W7_E1B19K-01        -----------caactgtt-----------------agagaacgcttcg-
A0A1L7NRH1_E1B19K-      -----------caactgtt-----------------agaggacgcttcg-
T1UFS4_E1B19K-01        -----------caactgtt-----------------agaggacgcttcg-
                                                                          

T2CI10_E1B19K-02        gagtcggcctggaccctccggtggaggaggcggaggagtagctgacttgt
T1UIP3_E1B19K-02        gagccggcctggaccctccggt---------ggaggagtagctgacctgt
J7I6Q4_E1B19K-02        gagccggcctggaccctccggt---------ggaggagtagctgacctgt
J7I6S4_E1B19K-02        gagccggcctggaccctccggt---------ggaggagtagctgacctgt
J7ID56_E1B19K-02        gagccggcctggaccctccggt---------ggaggagtagctgacctgt
T1UF50_E1B19K-02        gagccggcctggaccctccggt---------ggaggagtagctgacctgt
I6LEP5_E1B19K-02        gagccggcctggaccctccggt---------ggaggagtagctgacctgt
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        gagccggcctggaccctccggt---------ggaggagtagctgacctgt
I6LES1_E1B19K-03        --------------------------------------------------
T2CI10_E1B19K-01        ----cgcctcggac--------------------ggagtctctggtc---
A0A0K0PX35_E1B19K-      ----cgcctcggac--------------------ggagtctctggcc---
A0A0K0PX99_E1B19K-      ----cgcctcggac--------------------ggagtctctggcc---
T1UIP3_E1B19K-01        ----cgcctcggac--------------------ggagtctctggct---
J7I6Q4_E1B19K-01        ----cgcctcggac--------------------ggagtctctggcc---
J7I6S4_E1B19K-01        ----cgcctcggac--------------------ggagtctctggcc---
J7ID56_E1B19K-01        ----cgcctcggac--------------------ggagtctctggcc---
I6LEP5_E1B19K-01        ----cgcctcggac--------------------ggagtctctggcc---
A0A6M6AA96_E1B19K-      ----cgcctcggac--------------------ggagtctctggcc---
I6LES1_E1B19K-01        ----cgcctcggac--------------------ggagtctctggcc---
T1UF50_E1B19K-01        ----cgcctcggac--------------------ggagtctctggcc---
J7I6W7_E1B19K-02        gagccggcctggaccctccagtggaggaggc---ggagtagctgacttgt
T1UFS4_E1B19K-02        gagccggcctggaccctccagtggaggaggc---ggagtagctgacttgt
T1UE63_E1B19K-02        gagccggcctggaccctccagtggaggaggc---ggagtagctgacttgt
T1UJX4_E1B19K-02        gagccggcctggaccctccagtggaggaggc---ggagtagctgacttgt
T1UJX4_E1B19K-01        ----------------------------gac---gga-----------gt
Q5UW22_E1B19K-01        ----------------------------gac---gga-----------gt
T1UE63_E1B19K-01        ----------------------------gac---gga-----------gt
J7I6W7_E1B19K-01        ----------------------------gac---gga-----------gt
A0A1L7NRH1_E1B19K-      ----------------------------gac---gga-----------gt
T1UFS4_E1B19K-01        ----------------------------gac---gga-----------gt
                                                                          

T2CI10_E1B19K-02        ttcctgaactgcgacgggtgcttactagatctacaaccagtggacgggac
T1UIP3_E1B19K-02        ttcctgaactgcgacgggtgcttactaggtctacgtccagtggacaggac
J7I6Q4_E1B19K-02        ttcctgaactgcgacgggtgcttactaggtctacgaccagtggacagaac
J7I6S4_E1B19K-02        ttcctgaactgcgacgggtgcttactaggtctacgaccagtggacagaac
J7ID56_E1B19K-02        ttcctgaactgcgacgggtgcttactaggtctacgaccagtggacagaac
T1UF50_E1B19K-02        ttcctgaactgcgacgggtgcttactaggtctacaaccagtggacagaac
I6LEP5_E1B19K-02        ttcctgaactgcgacgggtgcttactaggtctacaaccagtggacagaac
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        ttcctgaactgcgacgggtgcttactaggtctacaaccagtggacagaac
I6LES1_E1B19K-03        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-02        ctcctgaactgcaacgggtgcttactggatctacgtccactggacgggat
T1UFS4_E1B19K-02        ctcctgaactgcaacgggtgcttactggatctacgtccactggacgggat
T1UE63_E1B19K-02        ctcctgaactgcaacgggtgcttactggatctacgtccactggacgggat
T1UJX4_E1B19K-02        ctcctgaactgcaacgggtgcttactggatctacgtccactggacgggat
T1UJX4_E1B19K-01        ctcc----------------------------------------------
Q5UW22_E1B19K-01        ctcc----------------------------------------------
T1UE63_E1B19K-01        ctcc----------------------------------------------
J7I6W7_E1B19K-01        ctcc----------------------------------------------
A0A1L7NRH1_E1B19K-      ctcc----------------------------------------------
T1UFS4_E1B19K-01        ctcc----------------------------------------------
                                                                          

T2CI10_E1B19K-02        aggggcattaagagggaaaggaatcctagtggaactaatcccagatctga
T1UIP3_E1B19K-02        aggggcattaagagggaaaggaatcctagtgggaataattcaagaaccga
J7I6Q4_E1B19K-02        agaggcattaagagggagaggaatcctagtgggaataattcaagaaccga
J7I6S4_E1B19K-02        agaggcattaagagggagaggaatcctagtgggaataattcaagaaccga
J7ID56_E1B19K-02        aggggcattaagagggagaggaatcctagtgggaacaattcaagaaccga
T1UF50_E1B19K-02        aggggcattaagagggagaggaatcctagtgggaacaattcaagaaccga
I6LEP5_E1B19K-02        aggggcattaagagggagaggaatcctagtgggaacaattcaagaaccga
I6LEP5_E1B19K-03        --------------------------------------------------
I6LES1_E1B19K-02        aggggcattaagagggagaggaatcctagtgggaacaattcaagaaccga
I6LES1_E1B19K-03        --------------------------------------------------
T2CI10_E1B19K-01        --------------------------------------------------
A0A0K0PX35_E1B19K-      --------------------------------------------------
A0A0K0PX99_E1B19K-      --------------------------------------------------
T1UIP3_E1B19K-01        --------------------------------------------------
J7I6Q4_E1B19K-01        --------------------------------------------------
J7I6S4_E1B19K-01        --------------------------------------------------
J7ID56_E1B19K-01        --------------------------------------------------
I6LEP5_E1B19K-01        --------------------------------------------------
A0A6M6AA96_E1B19K-      --------------------------------------------------
I6LES1_E1B19K-01        --------------------------------------------------
T1UF50_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-02        aggggcgttaaaagggagagggcatctagtggtactgatgctagatctga
T1UFS4_E1B19K-02        aggggcgttaagagggagagggcatctagtggtactgatgctagatctga
T1UE63_E1B19K-02        aggggcgttaagagggagagggcatccagtggtactgatgctagatctga
T1UJX4_E1B19K-02        aggggcgttaagagggagagggcatccagtggtactgatgctagatctga
T1UJX4_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
                                                                          

T2CI10_E1B19K-02        gttggctttaagtttgatgagtcgcagacgtcctgaaactatatggtggc
T1UIP3_E1B19K-02        gttggctttaagtttaatgagccgtaggcgtcctgaaactgtttggtggc
J7I6Q4_E1B19K-02        gttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggc
J7I6S4_E1B19K-02        gttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggc
J7ID56_E1B19K-02        gttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggc
T1UF50_E1B19K-02        gttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggc
I6LEP5_E1B19K-02        gttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggc
I6LEP5_E1B19K-03        ----------------atgagccgcaggcgtcctgaaactgtttggtggc
I6LES1_E1B19K-02        gttggctttaagtttaatgagccgcaggcgtcctgaaactgtttggtggc
I6LES1_E1B19K-03        ----------------atgagccgcaggcgtcctgaaactgtttggtggc
T2CI10_E1B19K-01        -----------------------------------------tttg-----
A0A0K0PX35_E1B19K-      -----------------------------------------tttg-----
A0A0K0PX99_E1B19K-      -----------------------------------------tttg-----
T1UIP3_E1B19K-01        -----------------------------------------tttg-----
J7I6Q4_E1B19K-01        -----------------------------------------tttg-----
J7I6S4_E1B19K-01        -----------------------------------------tttg-----
J7ID56_E1B19K-01        -----------------------------------------tttg-----
I6LEP5_E1B19K-01        -----------------------------------------tttg-----
A0A6M6AA96_E1B19K-      -----------------------------------------tttg-----
I6LES1_E1B19K-01        -----------------------------------------tttg-----
T1UF50_E1B19K-01        -----------------------------------------tttg-----
J7I6W7_E1B19K-02        gttggctttaagtttaatgagtcgcagacgtcctgaaaccatttggtggc
T1UFS4_E1B19K-02        gttggctttaagtttaatgagtcgcagacgtcctgaaaccatttggtggc
T1UE63_E1B19K-02        gttggctttaagtttaatgagtcgcagacgtcctgaaaccatttggtggc
T1UJX4_E1B19K-02        gttggctttaagtttaatgtctcgcagacgtcctgaaaccatttggtggc
T1UJX4_E1B19K-01        ---ggtttt-----------------------------------------
Q5UW22_E1B19K-01        ---ggtttt-----------------------------------------
T1UE63_E1B19K-01        ---ggtttt-----------------------------------------
J7I6W7_E1B19K-01        ---ggtttt-----------------------------------------
A0A1L7NRH1_E1B19K-      ---ggtttt-----------------------------------------
T1UFS4_E1B19K-01        ---ggtttt-----------------------------------------
                                                                          

T2CI10_E1B19K-02        atgaggttcagaatgagggcagggatgaagtatcaatattgcaagagaaa
T1UIP3_E1B19K-02        atgaggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaa
J7I6Q4_E1B19K-02        atgaggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaa
J7I6S4_E1B19K-02        atgaggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaa
J7ID56_E1B19K-02        atgaggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaa
T1UF50_E1B19K-02        atgaggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaa
I6LEP5_E1B19K-02        atgaggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaa
I6LEP5_E1B19K-03        atgaggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaa
I6LES1_E1B19K-02        atgaggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaa
I6LES1_E1B19K-03        atgaggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaa
T2CI10_E1B19K-01        --gagattc-----------------------------------------
A0A0K0PX35_E1B19K-      --gagattc-----------------------------------------
A0A0K0PX99_E1B19K-      --gagattc-----------------------------------------
T1UIP3_E1B19K-01        --gagattc-----------------------------------------
J7I6Q4_E1B19K-01        --gagattc-----------------------------------------
J7I6S4_E1B19K-01        --gagattc-----------------------------------------
J7ID56_E1B19K-01        --gagattc-----------------------------------------
I6LEP5_E1B19K-01        --gagattc-----------------------------------------
A0A6M6AA96_E1B19K-      --gagattc-----------------------------------------
I6LES1_E1B19K-01        --gagattc-----------------------------------------
T1UF50_E1B19K-01        --gagattc-----------------------------------------
J7I6W7_E1B19K-02        atgaggtccagaaagagggaagggatgaagtttctgtattgcaggagaaa
T1UFS4_E1B19K-02        atgaggtccagaaagagggaagggatgaagtttctgtattgcaggagaaa
T1UE63_E1B19K-02        atgaggttcagaaagagggaagggatgaagtttctgtattgcaggagaaa
T1UJX4_E1B19K-02        atgaggttcagaaagagggaagggatgaagtttctgtattgcaggagaaa
T1UJX4_E1B19K-01        -------------------------tggagattctggttcgctagtgaat
Q5UW22_E1B19K-01        -------------------------tggagattctggttcgctagtgaat
T1UE63_E1B19K-01        -------------------------tggagattctggttcgctagtgaat
J7I6W7_E1B19K-01        -------------------------tggagattctggttcgctagtgaat
A0A1L7NRH1_E1B19K-      -------------------------tggagattctggttcgctagtgaat
T1UFS4_E1B19K-01        -------------------------tggagattctggttcgctagtgaat
                                                                          

T2CI10_E1B19K-02        tattctctagaacaggtgaaaacatgttggttggagcctgaggatgattg
T1UIP3_E1B19K-02        tattcactagaacaacttaagacctgttggttggaacctgaggatgattg
J7I6Q4_E1B19K-02        tattcactagaacaacttaagacctgttggttggaacctgaggatgattg
J7I6S4_E1B19K-02        tattcactagaacaacttaagacctgttggttggaacctgaggatgattg
J7ID56_E1B19K-02        tattcactagaacaacttaagacctgttggttggaacctgaggatgattg
T1UF50_E1B19K-02        tattcactagaacaacttaagacctgttggttggaacctgaggatgattg
I6LEP5_E1B19K-02        tattcactagaacaacttaagacctgttggttggaacctgaggatgattg
I6LEP5_E1B19K-03        tattcactagaacaacttaagacctgttggttggaacctgaggatgattg
I6LES1_E1B19K-02        tattcactagaacaacttaagacctgttggttggaacctgaggatgattg
I6LES1_E1B19K-03        tattcactagaacaacttaagacctgttggttggaacctgaggatgattg
T2CI10_E1B19K-01        --------------------------------------------tggttc
A0A0K0PX35_E1B19K-      --------------------------------------------tggttc
A0A0K0PX99_E1B19K-      --------------------------------------------tggttc
T1UIP3_E1B19K-01        --------------------------------------------tggttc
J7I6Q4_E1B19K-01        --------------------------------------------tggttc
J7I6S4_E1B19K-01        --------------------------------------------tggttc
J7ID56_E1B19K-01        --------------------------------------------tggttc
I6LEP5_E1B19K-01        --------------------------------------------tggttc
A0A6M6AA96_E1B19K-      --------------------------------------------tggttc
I6LES1_E1B19K-01        --------------------------------------------tggttc
T1UF50_E1B19K-01        --------------------------------------------tggttc
J7I6W7_E1B19K-02        tattcactggaacaggtgaaaacatgttggttggagcctgaggatgattg
T1UFS4_E1B19K-02        tattcactggaacaggtgaaaacatgttggttggagcctgaggatgattg
T1UE63_E1B19K-02        tattcactggaacaggtgaaaacatgttggttggagccagaggatgattg
T1UJX4_E1B19K-02        tattcactggaacaggtgaaaacatgttggttggagccagaggatgattg
T1UJX4_E1B19K-01        ta------------------------------------------------
Q5UW22_E1B19K-01        ta------------------------------------------------
T1UE63_E1B19K-01        ta------------------------------------------------
J7I6W7_E1B19K-01        ta------------------------------------------------
A0A1L7NRH1_E1B19K-      ta------------------------------------------------
T1UFS4_E1B19K-01        ta------------------------------------------------
                                                                          

T2CI10_E1B19K-02        ggaggttgccattaggaattatgccaagatagctttgaggcctgataaat
T1UIP3_E1B19K-02        ggaggtggccattaggaattatgctaagatatctctgaggcctgataaac
J7I6Q4_E1B19K-02        ggaggtggccattaggaattatgctaagatatctctgaggcctgataaac
J7I6S4_E1B19K-02        ggaggtggccattaggaattatgctaagatatctctgaggcctgataaac
J7ID56_E1B19K-02        ggaggtggccattaggaattatgctaagatatctctgaggcctgataaac
T1UF50_E1B19K-02        ggaggtggccattaggaattatgctaagatatctctgaggcctgataaac
I6LEP5_E1B19K-02        ggaggtggccattaggaattatgctaagatatctctgaggcctgataaac
I6LEP5_E1B19K-03        ggaggtggccattaggaattatgctaagatatctctgaggcctgataaac
I6LES1_E1B19K-02        ggaggtggccattaggaattatgctaagatatctctgaggcctgataaac
I6LES1_E1B19K-03        ggaggtggccattaggaattatgctaagatatctctgaggcctgataaac
T2CI10_E1B19K-01        ggtggtg----------atctggctagactagtctttaga--------at
A0A0K0PX35_E1B19K-      ggtggtg----------atctagctaggctagtctttagg--------at
A0A0K0PX99_E1B19K-      ggtggtg----------atctagctaggctagtctttagg--------at
T1UIP3_E1B19K-01        ggtggtg----------atctagctaggctagtgtttagg--------at
J7I6Q4_E1B19K-01        ggtggtg----------atctagctaggctagtgtttagg--------at
J7I6S4_E1B19K-01        ggtggtg----------atctagctaggctagtgtttagg--------at
J7ID56_E1B19K-01        ggtggtg----------atctagctaggctagtgtttagg--------at
I6LEP5_E1B19K-01        ggtggtg----------atctagctaggctagtgtttagg--------at
A0A6M6AA96_E1B19K-      ggtggtg----------atctagctaggctagtgtttagg--------at
I6LES1_E1B19K-01        ggtggtg----------atctagctaggctagtgtttagg--------at
T1UF50_E1B19K-01        ggtggtg----------atctagctaggctagtgtttagg--------at
J7I6W7_E1B19K-02        ggaggtggccattaaaaattatgccaagatagctttgaggcctgataaac
T1UFS4_E1B19K-02        ggaggtggccattaaaaattatgccaagatagctttgaggcctgataaac
T1UE63_E1B19K-02        ggaggtggccattaaaaattatgccaagatagctttgaggcctgataaac
T1UJX4_E1B19K-02        ggaggtggccattaaaaattatgcgaagatagctttgaggcctgataagc
T1UJX4_E1B19K-01        ----------------------gctagggtagtttttag----gataaa-
Q5UW22_E1B19K-01        ----------------------gctagggtagtttttag----gataaa-
T1UE63_E1B19K-01        ----------------------gctagggtagtttttag----gataaa-
J7I6W7_E1B19K-01        ----------------------gctagggtagtttttag----gataaa-
A0A1L7NRH1_E1B19K-      ----------------------gctagggtagtttttag----gataaa-
T1UFS4_E1B19K-01        ----------------------gctagggtagtttttag----gataaa-
                                              ** *   **    * **           

T2CI10_E1B19K-02        tgtacagaattactaaacggattaatattagaaatgcatgttatatatca
T1UIP3_E1B19K-02        agtatagaattactaagaagattaatattagaaatgcatgctacatatca
J7I6Q4_E1B19K-02        aatatagaattactaagaagattaatattagaaatgcatgctacatatca
J7I6S4_E1B19K-02        aatatagaattactaagaagattaatattagaaatgcatgctacatatca
J7ID56_E1B19K-02        aatatagaattactaagaagattaatattagaaatgcatgctacatatca
T1UF50_E1B19K-02        aatatagaattactaagaagattaatattagaaatgcatgctacatatca
I6LEP5_E1B19K-02        aatatagaattactaagaagattaatattagaaatgcatgctacatatca
I6LEP5_E1B19K-03        aatatagaattactaagaagattaatattagaaatgcatgctacatatca
I6LES1_E1B19K-02        aatatagaattactaagaagattaatattagaaatgcatgctacatatca
I6LES1_E1B19K-03        aatatagaattactaagaagattaatattagaaatgcatgctacatatca
T2CI10_E1B19K-01        aaaacaggattacaggcaaga-----atttgaaa----------------
A0A0K0PX35_E1B19K-      aaaacaggactacagggaaga-----atttgaaa----------------
A0A0K0PX99_E1B19K-      aaaacaggactacagggaaga-----atttgaaa----------------
T1UIP3_E1B19K-01        aaaacaggactacagggaaga-----atttgaaa----------------
J7I6Q4_E1B19K-01        aaaacaggactacagcgtaga-----atttgaaa----------------
J7I6S4_E1B19K-01        aaaacaggactacagcgtaga-----atttgaaa----------------
J7ID56_E1B19K-01        aaaacaggactacagggaaga-----atttgaaa----------------
I6LEP5_E1B19K-01        aaaacaggactacagggaaga-----atttgaaa----------------
A0A6M6AA96_E1B19K-      aaaacaggactacagggaaga-----atttgaaa----------------
I6LES1_E1B19K-01        aaaacaggactacagggaaga-----atttgaaa----------------
T1UF50_E1B19K-01        aaaacaggactacagggaaga-----atttgaaa----------------
J7I6W7_E1B19K-02        agtataagattactagacggattaatatccggaatgcttgttacatatct
T1UFS4_E1B19K-02        agtataagattactagacggattaatatccggaatgcttgttacatatct
T1UE63_E1B19K-02        agtataagatcagtagacggattaatatccggaatgcttgttacatatct
T1UJX4_E1B19K-02        agtataagatcactagacggattaatatccggaatgcttgttacatatct
T1UJX4_E1B19K-01        ---acaggactataaagaaga-------------------------attt
Q5UW22_E1B19K-01        ---acaggactataaacaaga-------------------------attt
T1UE63_E1B19K-01        ---acaggactataaacaaga-------------------------attt
J7I6W7_E1B19K-01        ---acaggactataaagaaga-------------------------attt
A0A1L7NRH1_E1B19K-      ---acaggactataaagaaga-------------------------attt
T1UFS4_E1B19K-01        ---acaggactataaagaaga-------------------------attt
                           * *  *  *       **                             

T2CI10_E1B19K-02        gggaatggggctgaggtagtgataga-cactcaagacagaacagttttta
T1UIP3_E1B19K-02        gggaatggggcagaggttataataga-tacacaagataaaacagctttta
J7I6Q4_E1B19K-02        gggaatggggcagaggttataataga-tacacaagataaagcagctttta
J7I6S4_E1B19K-02        gggaatggggcagaggttataataga-tacacaagataaagcagctttta
J7ID56_E1B19K-02        gggaatggggcagaggttataataga-tacacaagataaagcagctttta
T1UF50_E1B19K-02        gggaatggggcagaggttataataga-tacacaagataaagcagctttta
I6LEP5_E1B19K-02        gggaatggggcagaggttataataga-tacacaagataaagcagctttta
I6LEP5_E1B19K-03        gggaatggggcagaggttataataga-tacacaagataaagcagctttta
I6LES1_E1B19K-02        gggaatggggcagaggttataataga-tacacaagataaagcagctttta
I6LES1_E1B19K-03        gggaatggggcagaggttataataga-tacacaagataaagcagctttta
T2CI10_E1B19K-01        -------------------------------------------------a
A0A0K0PX35_E1B19K-      -------------------------------------------------a
A0A0K0PX99_E1B19K-      -------------------------------------------------a
T1UIP3_E1B19K-01        -------------------------------------------------a
J7I6Q4_E1B19K-01        -------------------------------------------------a
J7I6S4_E1B19K-01        -------------------------------------------------a
J7ID56_E1B19K-01        -------------------------------------------------a
I6LEP5_E1B19K-01        -------------------------------------------------a
A0A6M6AA96_E1B19K-      -------------------------------------------------a
I6LES1_E1B19K-01        -------------------------------------------------a
T1UF50_E1B19K-01        -------------------------------------------------a
J7I6W7_E1B19K-02        ggaaatggggctgaggtggtaataga-tactccagacaagacagttatta
T1UFS4_E1B19K-02        ggaaatggggctgaggtggtaataga-tactcaagacaaggcagttatta
T1UE63_E1B19K-02        ggaaatggggctgaggtggtaataga-tactcaagacaagacagttatta
T1UJX4_E1B19K-02        ggaaatggggctgaggtggtaataga-tactcaagacaagacagttatta
T1UJX4_E1B19K-01        gaaa---------agttgttggtagattgcccaggac--------ttttt
Q5UW22_E1B19K-01        gaaa---------agttgttggtagattgcccaggac--------ttttt
T1UE63_E1B19K-01        gaaa---------agttgttggtagattgcccaggac--------ttttt
J7I6W7_E1B19K-01        gaaa---------agttgttggtagattgcccaggac--------ttttt
A0A1L7NRH1_E1B19K-      gaaa---------agttgttgctagattgcccaggac--------ttttt
T1UFS4_E1B19K-01        gaaa---------agttgttggtagattgcccaggac--------ttttt
                                                                          

T2CI10_E1B19K-02        gatgctgcatgatgggtatgtggccaggggtggttggcatggaggcagta
T1UIP3_E1B19K-02        gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagta
J7I6Q4_E1B19K-02        gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagta
J7I6S4_E1B19K-02        gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagta
J7ID56_E1B19K-02        gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagta
T1UF50_E1B19K-02        gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagta
I6LEP5_E1B19K-02        gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagta
I6LEP5_E1B19K-03        gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagta
I6LES1_E1B19K-02        gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagta
I6LES1_E1B19K-03        gatgttgtatgatgggtatgtggccaggggttgtcggcatggaagcagta
T2CI10_E1B19K-01        gttattggacgact-------gtccaggacttttt------gaagc----
A0A0K0PX35_E1B19K-      gttattggacgaca-------gtccaggacttttt------gaagc----
A0A0K0PX99_E1B19K-      gttattggacgaca-------gtccaggacttttt------gaagc----
T1UIP3_E1B19K-01        gttattggacgaca-------gtccaggacttttt------gaagc----
J7I6Q4_E1B19K-01        gttattggacgaca-------gtccaggacttttt------gaagc----
J7I6S4_E1B19K-01        gttattggacgaca-------gtccaggacttttt------gaagc----
J7ID56_E1B19K-01        gttattggacgaca-------gtccaggacttttt------gaagc----
I6LEP5_E1B19K-01        gttattggacgaca-------gtccaggacttttt------gaagc----
A0A6M6AA96_E1B19K-      gttattggacgaca-------gtccaggacttttt------gaagc----
I6LES1_E1B19K-01        gttattggacgaca-------gtccaggacttttt------gaagc----
T1UF50_E1B19K-01        gttattggacgaca-------gtccaggacttttt------gaagc----
J7I6W7_E1B19K-02        gatgctgcatgatggatatgtggcctggagtagtcggtatggaagcagta
T1UFS4_E1B19K-02        gatgctgcatgatggatatgtggcctggagtagtcggtatggaagcagta
T1UE63_E1B19K-02        gatgctgcatgatggatatgtggcctggagtagtcggtatggaagcagtc
T1UJX4_E1B19K-02        gatgctgcatgatggatatgtggcctggagtagtcggtatggaagcagtc
T1UJX4_E1B19K-01        gaagct-----cttaatttgggccaccaggttcactttaaagaaaaag--
Q5UW22_E1B19K-01        gaagct-----cttaatttgggccatcaggttcactttaaagaaaaag--
T1UE63_E1B19K-01        gaagct-----cttaatttgggccatcaggttcactttaaagaaaaag--
J7I6W7_E1B19K-01        gaagct-----cttaatttgggtcatcaagttcactttaaagaaaaag--
A0A1L7NRH1_E1B19K-      gaagct-----cttaatttgggtcatcaagttcactttaaagaaaaag--
T1UFS4_E1B19K-01        gaagct-----cttaatttgggccatcaagttcactttaaagaaaaag--
                        *    *               * *      *          **       

T2CI10_E1B19K-02        acccttatgaatgtaaagtttagaggggatgggtataatggtgtggtttt
T1UIP3_E1B19K-02        acatttatgaatattaggtttaaaggggatgggtataatggcattgtatt
J7I6Q4_E1B19K-02        acacttatgaatattaggtttagaggggatgggtataatggcattgtatt
J7I6S4_E1B19K-02        acacttatgaatattaggtttagaggggatgggtataatggcattgtatt
J7ID56_E1B19K-02        acacttatgaatattaggtttagaggggatgggtataatggcattgtatt
T1UF50_E1B19K-02        acacttatgaatattaggtttagaggggatgggtataatggcattgtatt
I6LEP5_E1B19K-02        acacttatgaatattaggtttagaggggatgggtataatggcattgtatt
I6LEP5_E1B19K-03        acacttatgaatattaggtttagaggggatgggtataatggcattgtatt
I6LES1_E1B19K-02        acacttatgaatattaggtttagaggggatgggtataatggcattgtatt
I6LES1_E1B19K-03        acacttatgaatattaggtttagaggggatgggtataatggcattgtatt
T2CI10_E1B19K-01        -----------tcttaact----------tgggc----------------
A0A0K0PX35_E1B19K-      -----------tcttaact----------tgggc----------------
A0A0K0PX99_E1B19K-      -----------tcttaact----------tgggt----------------
T1UIP3_E1B19K-01        -----------tcttaact----------tgggc----------------
J7I6Q4_E1B19K-01        -----------tcttaact----------tgggt----------------
J7I6S4_E1B19K-01        -----------tcttaact----------tgggt----------------
J7ID56_E1B19K-01        -----------tcttaact----------tgggt----------------
I6LEP5_E1B19K-01        -----------tcttaact----------tgggt----------------
A0A6M6AA96_E1B19K-      -----------tcttaact----------tgggt----------------
I6LES1_E1B19K-01        -----------tcttaact----------tgggt----------------
T1UF50_E1B19K-01        -----------tcttaact----------tgggt----------------
J7I6W7_E1B19K-02        acttttgtaaatgttaagtttaggggagatggttataatggaatagtgtt
T1UFS4_E1B19K-02        acttttgtaaatgttaagtttaggggagatggttataatggaatagtgtt
T1UE63_E1B19K-02        acttttgtaaatgttaagtttaggggagatggttataatggaatagtgtt
T1UJX4_E1B19K-02        acttttgtaaatgttaagtttaggggagatggttataatggaatagtgtt
T1UJX4_E1B19K-01        --ttttatcagttttagact----------------------------tt
Q5UW22_E1B19K-01        --ttttatcagttttagact----------------------------tt
T1UE63_E1B19K-01        --ttttatcagttttagact----------------------------tt
J7I6W7_E1B19K-01        --ttttatcagttttagact----------------------------tt
A0A1L7NRH1_E1B19K-      --ttttatcagttttagact----------------------------tt
T1UFS4_E1B19K-01        --ttttatcagttttagact----------------------------tt
                                   * * *                                  

T2CI10_E1B19K-02        tatggctaatactaaattgattttgc----atggttgtagcttttttggt
T1UIP3_E1B19K-02        tatggctaacactaagctgattctac----atggttgtagcttttttggg
J7I6Q4_E1B19K-02        tatggctaacactaagctgattctac----atggttgtagcttttttggg
J7I6S4_E1B19K-02        tatggctaacactaagctgattctac----atggttgtagcttttttggg
J7ID56_E1B19K-02        tatggctaacactaagctgattctac----atggttgtagcttttttggg
T1UF50_E1B19K-02        tatggctaacactaagctgattctac----atggttgtagcttttttggg
I6LEP5_E1B19K-02        tatggctaacactaagctgattctac----atggttgtagcttttttggg
I6LEP5_E1B19K-03        tatggctaacactaagctgattctac----atggttgtagcttttttggg
I6LES1_E1B19K-02        tatggctaacactaagctgattctac----atggttgtagcttttttggg
I6LES1_E1B19K-03        tatggctaacactaagctgattctac----atggttgtagcttttttggg
T2CI10_E1B19K-01        ---------caccaggctcattttaaggagaaggttttatcagttttgga
A0A0K0PX35_E1B19K-      ---------catcaggctcattttaaggagaaggttttatcagttttaga
A0A0K0PX99_E1B19K-      ---------catcaggctcattttaaggagaaggttttatcagttttaga
T1UIP3_E1B19K-01        ---------catcaggctcattttaaggagaaggttttatcagttttaga
J7I6Q4_E1B19K-01        ---------catcaggctcattttaaggagaaggttttatcagttttaga
J7I6S4_E1B19K-01        ---------catcaggctcattttaaggagaaggttttatcagttttaga
J7ID56_E1B19K-01        ---------catcaggctcattttaaggagaaggttttatcagttttaga
I6LEP5_E1B19K-01        ---------catcgggctcattttaaggagaaggttttatcagttttaga
A0A6M6AA96_E1B19K-      ---------catcaggctcattttaaggagaaggttttatcagttttaga
I6LES1_E1B19K-01        ---------catcaggctcattttaaggagaaggttttatcagttttaga
T1UF50_E1B19K-01        ---------catcaggctcattttaaggagaaggttttatcagttttaga
J7I6W7_E1B19K-02        tatggccaataccaaacttatattgc----atggttgtagcttttttggt
T1UFS4_E1B19K-02        tatggccaataccaaacttatattgc----atggttgtagcttttttggt
T1UE63_E1B19K-02        tatggccaataccaaacttatattgc----atggttgtagcttttttggt
T1UJX4_E1B19K-02        tatggccaataccaaacttatattgc----atggttgtagcttttttggt
T1UJX4_E1B19K-01        tcaaccccaggtagaactgccgctgc---------tgtggcttttcttac
Q5UW22_E1B19K-01        tcaaccccaggtagaactgctgctgc---------tgtggcttttcttac
T1UE63_E1B19K-01        tcaaccccaggtagaactgctgctgc---------tgtggcttttcttac
J7I6W7_E1B19K-01        tcgaccccaggtagaactgccgctgc---------tgtggcttttcttac
A0A1L7NRH1_E1B19K-      tcaaccccaggtagaactgccgctgc---------tgtggcttttcttac
T1UFS4_E1B19K-01        tcaaccccaggtagaactgccgctgc---------tgtggcttttcttac
                                         *     *           * *  *  ** *   

T2CI10_E1B19K-02        tttaataatatatgtgtggaa--gcttgggggcaggtgagtgtaagaggc
T1UIP3_E1B19K-02        tttaataatacttgtgtagaa--gcttgggggcaagttagtgtgaggggt
J7I6Q4_E1B19K-02        tttaataatacgtgtgtagaa--gcttgggggcaagttagtgtgaggggt
J7I6S4_E1B19K-02        tttaataatacgtgtgtagaa--gcttgggggcaagttagtgtgaggggt
J7ID56_E1B19K-02        tttaataatacgtgtgtagaa--gcttgggggcaagttagtgtgaggggt
T1UF50_E1B19K-02        tttaataatacgtgtgtagaa--gcttgggggcaagttagtgtgaggggt
I6LEP5_E1B19K-02        tttaataatacgtgtgtagaa--gcttgggggcaagttagtgtaaggggt
I6LEP5_E1B19K-03        tttaataatacgtgtgtagaa--gcttgggggcaagttagtgtaaggggt
I6LES1_E1B19K-02        tttaataatacgtgtgtagaa--gcttgggggcaagttagtgtaaggggt
I6LES1_E1B19K-03        tttaataatacgtgtgtagaa--gcttgggggcaagttagtgtaaggggt
T2CI10_E1B19K-01        tttttctacccctg-gtagaactgct-------------------gctgc
A0A0K0PX35_E1B19K-      tttttctactcctg-gtagaactgct-------------------gctgc
A0A0K0PX99_E1B19K-      tttttctactcctg-gtagaactgct-------------------gctgc
T1UIP3_E1B19K-01        tttttctactcctg-gtagaactgct-------------------gctgc
J7I6Q4_E1B19K-01        tttttctactcctg-gtagaactgct-------------------gctgc
J7I6S4_E1B19K-01        tttttctactcctg-gtagaactgct-------------------gctgc
J7ID56_E1B19K-01        tttttctactcctg-gtagaactgct-------------------gctgc
I6LEP5_E1B19K-01        tttttctactcctg-gtagaactgct-------------------gctgc
A0A6M6AA96_E1B19K-      tttttctactcctg-gtagaactgct-------------------gctgc
I6LES1_E1B19K-01        tttttctactcctg-gtagaactgct-------------------gctgc
T1UF50_E1B19K-01        tttttctactcctg-gtagaactgct-------------------gctgc
J7I6W7_E1B19K-02        tttaacaatacctgtgtagat--gcctggggacaggttagtgtacgggga
T1UFS4_E1B19K-02        ttcaacaatacctgtgtagat--gcctggggacaggttagtgtacgggga
T1UE63_E1B19K-02        ttcaacaatacctgtgtagat--gcctggggacaggttagtgtacggggg
T1UJX4_E1B19K-02        ttcaacaatacctgtgtagat--gcctggggacaggttagtgtgcggggg
T1UJX4_E1B19K-01        ttttatattagacaaatggat---cccgcagactcatttcagcagggg--
Q5UW22_E1B19K-01        ttttatattagataaatggat---cccgcagactcatttcagcagggg--
T1UE63_E1B19K-01        ttttatattagataaatggat---cccgcagactcatttcagcagggg--
J7I6W7_E1B19K-01        ttttatattagataaatggat---cccgcagactcatttcagcagggg--
A0A1L7NRH1_E1B19K-      ttttatattagataaatggat---cccgcagactcatttcagcagggg--
T1UFS4_E1B19K-01        ttttatattagataaatggat---cccgcagactcatttcagcagggg--
                        **              * **    *                    *    

T2CI10_E1B19K-02        tgtagtttctatgcatgctggatt-----gcaacatcaggcaggaccaag
T1UIP3_E1B19K-02        tgtagtttttatgcatgctggatt-----gcaacatcaggtagggtcaag
J7I6Q4_E1B19K-02        tgtagtttttatgcatgctggatt-----gcaacatcaggtagggtcaag
J7I6S4_E1B19K-02        tgtagtttttatgcatgctggatt-----gcaacatcaggtagggtcaag
J7ID56_E1B19K-02        tgtagtttttatgcatgctggatt-----gcaacatcaggtagggtgaag
T1UF50_E1B19K-02        tgtagtttttatgcatgctggatt-----gcaacatcaggtagggtgaag
I6LEP5_E1B19K-02        tgtagtttttatgcatgctggatt-----gcaacatcaggtagggtgaag
I6LEP5_E1B19K-03        tgtagtttttatgcatgctggatt-----gcaacatcaggtagggtgaag
I6LES1_E1B19K-02        tgtagtttttatgcatgctggatt-----gcaacatcaggtagggtgaag
I6LES1_E1B19K-03        tgtagtttttatgcatgctggatt-----gcaacatcaggtagggtgaag
T2CI10_E1B19K-01        tgtagctttcct--------------------------------------
A0A0K0PX35_E1B19K-      tgtagcctttct--------------------------------------
A0A0K0PX99_E1B19K-      tgtagcctttct--------------------------------------
T1UIP3_E1B19K-01        tgtagcttttct--------------------------------------
J7I6Q4_E1B19K-01        tgtagcttttct--------------------------------------
J7I6S4_E1B19K-01        tgtagcttttct--------------------------------------
J7ID56_E1B19K-01        tgtagcttttct--------------------------------------
I6LEP5_E1B19K-01        tgtagcttttct--------------------------------------
A0A6M6AA96_E1B19K-      tgtagcttttct--------------------------------------
I6LES1_E1B19K-01        tgtagcttttct--------------------------------------
T1UF50_E1B19K-01        tgtagcttttct--------------------------------------
J7I6W7_E1B19K-02        tgtagtttctatgcgtgttggatt-----gccacagctggcagaaccaag
T1UFS4_E1B19K-02        tgtagtttctatgcgtgttggatt-----gccacagctggcagaaccaag
T1UE63_E1B19K-02        tgtagtttctatgcgtgttggatt-----gccacagctggcagaaccaag
T1UJX4_E1B19K-02        tgtagtttctatgcgtgttggatt-----gccacagcaggcagaaccaag
T1UJX4_E1B19K-01        ----------atacgttttggatttcatagccacagc-------------
Q5UW22_E1B19K-01        ----------atacgttttggatttcatagccacagc-------------
T1UE63_E1B19K-01        ----------atacgttttggatttcatagccacagc-------------
J7I6W7_E1B19K-01        ----------atacgttttggatttcgtagccacagc-------------
A0A1L7NRH1_E1B19K-      ----------atacgttttggatttcatagccacagc-------------
T1UFS4_E1B19K-01        ----------atacgttttggatttcgtagccacagc-------------
                                   *                                      

T2CI10_E1B19K-02        agtcaattgtctgtaaagaaatgtatgtttgagagatgtaacctgggcat
T1UIP3_E1B19K-02        agtcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcat
J7I6Q4_E1B19K-02        agtcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcat
J7I6S4_E1B19K-02        agtcagttgtctgtgaagaaatgcatgtttgagagatgtaatcttggcat
J7ID56_E1B19K-02        agtcagttgtctgtaaagaaatgcatgtttgagagatgtaatcttggcat
T1UF50_E1B19K-02        agtcagttgtctgtaaagaaatgcatgtttgagagatgtaatcttggcat
I6LEP5_E1B19K-02        agtcagttgtctgtaaagaaatgcatgtttgagagatgtaatcttggcat
I6LEP5_E1B19K-03        agtcagttgtctgtaaagaaatgcatgtttgagagatgtaatcttggcat
I6LES1_E1B19K-02        agtcagttgtctgtaaagaaatgcatgtttgagagatgtaatcttggcat
I6LES1_E1B19K-03        agtcagttgtctgtaaagaaatgcatgtttgagagatgtaatcttggcat
T2CI10_E1B19K-01        -----------------tacattcatatttgataaat-------------
A0A0K0PX35_E1B19K-      -----------------tacttttatattggataaat-------------
A0A0K0PX99_E1B19K-      -----------------tacttttatattggataaat-------------
T1UIP3_E1B19K-01        -----------------tacttttatattggataaat-------------
J7I6Q4_E1B19K-01        -----------------tacttttatattggataaat-------------
J7I6S4_E1B19K-01        -----------------tacttttatattggataaat-------------
J7ID56_E1B19K-01        -----------------tacttttatattggataaat-------------
I6LEP5_E1B19K-01        -----------------tacttttatattggataaat-------------
A0A6M6AA96_E1B19K-      -----------------tacttttatattggataaat-------------
I6LES1_E1B19K-01        -----------------tacttttatattggataaat-------------
T1UF50_E1B19K-01        -----------------tacttttatattggataaat-------------
J7I6W7_E1B19K-02        agtcaattgtctctgaagaaatgcatattccaaagatgtaacctgggcat
T1UFS4_E1B19K-02        agtcaattgtctctgaagaaatgcatattccaaagatgtaacctgggcat
T1UE63_E1B19K-02        agtcaattgtctctgaagaaatgcatattccaaagatgtaacctgggcat
T1UJX4_E1B19K-02        agtcaattgtctctgaagaaatgcatattccaaagatgtaacctgggcat
T1UJX4_E1B19K-01        -----attg----tggag---------------------aacatgg----
Q5UW22_E1B19K-01        -----attg----tggag---------------------aacatgg----
T1UE63_E1B19K-01        -----attg----tggag---------------------aacatgg----
J7I6W7_E1B19K-01        -----attg----tggag---------------------aacatgg----
A0A1L7NRH1_E1B19K-      -----attg----tggag---------------------aacatgg----
T1UFS4_E1B19K-01        -----attg----tggag---------------------aacatgg----
                                                                          

T2CI10_E1B19K-02        actgaatgaaggagaagccagagtcagccactgtgcttcttccgaaactg
T1UIP3_E1B19K-02        actgaatgaaggtgaagcaagggtccgccactgcgcagctacagaaactg
J7I6Q4_E1B19K-02        actgaatgaaggtgaagcaaggatccgccactgcgcagctacagaaactg
J7I6S4_E1B19K-02        actgaatgaaggtgaagcaaggatccgccactgcgcagctacagaaactg
J7ID56_E1B19K-02        actgaatgaaggtgaagcaagggtccgccactgcgcggctacacaaactg
T1UF50_E1B19K-02        actgaatgaaggtgaagcaagggtccgccactgcgcggctacagaaactg
I6LEP5_E1B19K-02        actgaatgaaggtgaagcaagggtccgccactgcgcggctacagaaactg
I6LEP5_E1B19K-03        actgaatgaaggtgaagcaagggtccgccactgcgcggctacagaaactg
I6LES1_E1B19K-02        actgaatgaaggtgaagcaagggtccgccactgcgcggctacagaaactg
I6LES1_E1B19K-03        actgaatgaaggtgaagcaagggtccgccactgcgcggctacagaaactg
T2CI10_E1B19K-01        --------------------ggatcccac---------------agaccc
A0A0K0PX35_E1B19K-      --------------------ggatccgcc---------------aaaccc
A0A0K0PX99_E1B19K-      --------------------ggatccgcc---------------aaaccc
T1UIP3_E1B19K-01        --------------------ggatccgcc---------------aaaccc
J7I6Q4_E1B19K-01        --------------------ggatccgcc---------------aaactc
J7I6S4_E1B19K-01        --------------------ggatccgcc---------------aaactc
J7ID56_E1B19K-01        --------------------ggatccgcc---------------aaactc
I6LEP5_E1B19K-01        --------------------ggatccgcc---------------aaactc
A0A6M6AA96_E1B19K-      --------------------ggatccgcc---------------aaactc
I6LES1_E1B19K-01        --------------------ggatccgcc---------------aaactc
T1UF50_E1B19K-01        --------------------ggatccgcc---------------aaactc
J7I6W7_E1B19K-02        tcttaatgaaggcgaagcaagggtccgccactgcgcttctacagatactg
T1UFS4_E1B19K-02        tctgaatgaaggcgaagcaagggtccgccactgcgcttctacagatactg
T1UE63_E1B19K-02        tctgaatgaaggcgaagcaagggtccgtcactgcgcttctacagatactg
T1UJX4_E1B19K-02        tctgaatgaaggcgaagcaagggtccgccactgcgcttctacagatactg
T1UJX4_E1B19K-01        -------------------aaggttcgcaa--------------------
Q5UW22_E1B19K-01        -------------------aaggttcgcaa--------------------
T1UE63_E1B19K-01        -------------------aaggttcgcaa--------------------
J7I6W7_E1B19K-01        -------------------aaggttcgcaa--------------------
A0A1L7NRH1_E1B19K-      -------------------aaggttcgcaa--------------------
T1UFS4_E1B19K-01        -------------------aaggttcgcaa--------------------
                                               *                          

T2CI10_E1B19K-02        gctgtttcatattgataaagggaaatgccaatgtgaaacataatatgatc
T1UIP3_E1B19K-02        gctgcttcattctaataaagggaaatgccagtgtgaagcataatatgatc
J7I6Q4_E1B19K-02        gctgcttcattctaataaagggaaatgccagtgtgaagcataatatgatc
J7I6S4_E1B19K-02        gctgcttcattctaataaagggaaatgccagtgtgaagcataatatgatc
J7ID56_E1B19K-02        gctgcttcattctaataaagggaaatgccagtgtaaagcataatatgatc
T1UF50_E1B19K-02        gctgcttcattctaataaagggaaatgccagtgtaaagcataatatgatc
I6LEP5_E1B19K-02        gctgctttattctaataaagggaaatgccagtgtaaagcataatatgatc
I6LEP5_E1B19K-03        gctgctttattctaataaagggaaatgccagtgtaaagcataatatgatc
I6LES1_E1B19K-02        gctgctttattctaataaagggaaatgccagtgtaaagcataatatgatc
I6LES1_E1B19K-03        gctgctttattctaataaagggaaatgccagtgtaaagcataatatgatc
T2CI10_E1B19K-01        acttc---------agcaagggatacg----------------------t
A0A0K0PX35_E1B19K-      acttc---------agcaagggatacg----------------------t
A0A0K0PX99_E1B19K-      acttc---------agcaggggatacg----------------------t
T1UIP3_E1B19K-01        acttc---------agcaagggatacg----------------------t
J7I6Q4_E1B19K-01        acttc---------agcaagggatacg----------------------t
J7I6S4_E1B19K-01        acttc---------agcaagggatacg----------------------t
J7ID56_E1B19K-01        acttc---------agcaagggatacg----------------------t
I6LEP5_E1B19K-01        acttc---------agcaagggatacg----------------------t
A0A6M6AA96_E1B19K-      acttc---------agcaagggatacg----------------------t
I6LES1_E1B19K-01        acttc---------agcaagggatacg----------------------t
T1UF50_E1B19K-01        acttc---------agcaagggatacg----------------------t
J7I6W7_E1B19K-02        gatgttttattttaattaagggcaatgccagcgtaaagcataacatgatt
T1UFS4_E1B19K-02        gatgttttattttaattaagggcaatgccagcgtaaagcataacatgatt
T1UE63_E1B19K-02        gatgttttattttaattaagggaaatgccagcgtaaagcataacatgatt
T1UJX4_E1B19K-02        gatgttttattttaattaagggaaatgccagcgtaaagcataacatgatt
T1UJX4_E1B19K-01        gatg--------------aggacaat------------------------
Q5UW22_E1B19K-01        gatg--------------aggacaat------------------------
T1UE63_E1B19K-01        gatg--------------aggacaat------------------------
J7I6W7_E1B19K-01        gatg--------------aggacaat------------------------
A0A1L7NRH1_E1B19K-      gatg--------------aggacaat------------------------
T1UFS4_E1B19K-01        gatg--------------aggacaat------------------------
                          *                **   *                         

T2CI10_E1B19K-02        tgtggaccctcagatgagaggccttatcagatgctgacatgtgctggcgg
T1UIP3_E1B19K-02        tgtggacattcgaatgagaggccttatcagatgctgacctgcgctggtgg
J7I6Q4_E1B19K-02        tgtggacattcggatgagaggccttatcagatgctgacctgcgctggtgg
J7I6S4_E1B19K-02        tgtggacattcggatgagaggccttatcagatgctgacctgcgctggtgg
J7ID56_E1B19K-02        tgtggacattcggatgagaggccttatcagatgctgacctgcgctggtgg
T1UF50_E1B19K-02        tgtggacattcggatgagaggccttatcagatgctgacctgcgctggtgg
I6LEP5_E1B19K-02        tgtggacattcggatgagaggccttatcagatgctgacctgcgctggtgg
I6LEP5_E1B19K-03        tgtggacattcggatgagaggccttatcagatgctgacctgcgctggtgg
I6LES1_E1B19K-02        tgtggacattcggatgagaggccttatcagatgctgacctgcgctggtgg
I6LES1_E1B19K-03        tgtggacattcggatgagaggccttatcagatgctgacctgcgctggtgg
T2CI10_E1B19K-01        tttggat-ttcatagcagcagctttg------------------tggaga
A0A0K0PX35_E1B19K-      tttggat-ttcatagcagcagctttg------------------tggaga
A0A0K0PX99_E1B19K-      tttggat-ttcatagcagcagctttg------------------tggaga
T1UIP3_E1B19K-01        tttggat-ttcatagcagcagctttg------------------tggaga
J7I6Q4_E1B19K-01        tttggat-ttcatagcagcagctttg------------------tggaga
J7I6S4_E1B19K-01        tttggat-ttcatagcagcagctttg------------------tggaga
J7ID56_E1B19K-01        tttggat-ttcatagcagcagctttg------------------tggaga
I6LEP5_E1B19K-01        tttggat-ttcatagcagcagctttg------------------tggaga
A0A6M6AA96_E1B19K-      tttggat-ttcatagcagcagctttg------------------tggaga
I6LES1_E1B19K-01        tttggat-ttcatagcagcagctttg------------------tggaga
T1UF50_E1B19K-01        tttggat-ttcatagcagcagctttg------------------tggaga
J7I6W7_E1B19K-02        tgcggtgcttccgatgagaggccttatcaaatgctcacttgtgccggtgg
T1UFS4_E1B19K-02        tgcggtgcttccgatgagaggccttatcaaatgctcacttgtgccggtgg
T1UE63_E1B19K-02        tgtggtgcttccgatgagaggccttatcaaatgctcacttgtgctggtgg
T1UJX4_E1B19K-02        tgcggtgcttccgatgagaggccttatcaaatgctcacttgtgctggtgg
T1UJX4_E1B19K-01        ----------------------ctta------------------------
Q5UW22_E1B19K-01        ----------------------ctta------------------------
T1UE63_E1B19K-01        ----------------------ctta------------------------
J7I6W7_E1B19K-01        ----------------------ctta------------------------
A0A1L7NRH1_E1B19K-      ----------------------ctta------------------------
T1UFS4_E1B19K-01        ----------------------ctta------------------------
                                               **                         

T2CI10_E1B19K-02        acattgcaatatgctggctaccgtgcatattgtttctcacccacgcaaga
T1UIP3_E1B19K-02        acattgcaatattcttgctaccgtgcatatcgtttcccatgcacgcaaga
J7I6Q4_E1B19K-02        acattgcaatattcttgctactgtgcatatcgtttcacatgcacgcaaga
J7I6S4_E1B19K-02        acattgcaatattcttgctactgtgcatatcgtttcacatgcacgcaaga
J7ID56_E1B19K-02        acattgcaatattcttgctaccgtgcatatcgtttcacatgcacgcaaga
T1UF50_E1B19K-02        acattgcaatattcttgctaccgtgcatatcgtttcacatgcacgcaaga
I6LEP5_E1B19K-02        acattgcaatattcttgctaccgtgcatatcgtttcacatgcacgcaaga
I6LEP5_E1B19K-03        acattgcaatattcttgctaccgtgcatatcgtttcacatgcacgcaaga
I6LES1_E1B19K-02        acattgcaatattcttgctaccgtgcatatcgtttcacatgcacgcaaga
I6LES1_E1B19K-03        acattgcaatattcttgctaccgtgcatatcgtttcacatgcacgcaaga
T2CI10_E1B19K-01        acatggaag-------------------------------gctcgcagga
A0A0K0PX35_E1B19K-      acatggaag-------------------------------gctcgcagga
A0A0K0PX99_E1B19K-      acatggaag-------------------------------gctcgcagga
T1UIP3_E1B19K-01        acatggaag-------------------------------gctcgcagga
J7I6Q4_E1B19K-01        acatggaag-------------------------------gctcgcagga
J7I6S4_E1B19K-01        acatggaag-------------------------------gctcgcagga
J7ID56_E1B19K-01        acatggaag-------------------------------gctcgcagga
I6LEP5_E1B19K-01        acatggaag-------------------------------gctcgcagga
A0A6M6AA96_E1B19K-      acatggaag-------------------------------gctcgcagga
I6LES1_E1B19K-01        acatggaag-------------------------------gctcgcagga
T1UF50_E1B19K-01        acatggaag-------------------------------gctcgcagga
J7I6W7_E1B19K-02        gcattgtaacatgctggctactgtgcatattgtttctcatcaacgcaaaa
T1UFS4_E1B19K-02        gcattgtaatatgctggctactgtgcatattgtttcccatcaacgcaaaa
T1UE63_E1B19K-02        gcattgtaatatgctggctactgtgcatattgtttcccatcaacgcaaaa
T1UJX4_E1B19K-02        gcattgtaatatgctggctactgtgcatattgtttcccaccaacgcaaaa
T1UJX4_E1B19K-01        ---------------ggttactg---------------------------
Q5UW22_E1B19K-01        ---------------ggttactg---------------------------
T1UE63_E1B19K-01        ---------------ggttactg---------------------------
J7I6W7_E1B19K-01        ---------------ggttactg---------------------------
A0A1L7NRH1_E1B19K-      ---------------ggttactg---------------------------
T1UFS4_E1B19K-01        ---------------ggttactg---------------------------
                                                                          

T2CI10_E1B19K-02        aatggcctgttttggaacataatgt--gatgaccaaatgcactatgcacg
T1UIP3_E1B19K-02        aatggcctgtatttgaacataatgt--gattaccaagtgcaccatgcaca
J7I6Q4_E1B19K-02        aatggcctgtatttgaacataatgt--gattaccaagtgcaccatgcaca
J7I6S4_E1B19K-02        aatggcctgtatttgaacataatgt--gattaccaagtgcaccatgcaca
J7ID56_E1B19K-02        aatggcctgtatttgaacataatgt--gattaccaagtgcaccatgcaca
T1UF50_E1B19K-02        aatggcctgtatttgaacataatgt--gattaccaagtgcaccatgcaca
I6LEP5_E1B19K-02        aatggcctgtatttgaacataatgt--gattaccaagtgcaccatgcaca
I6LEP5_E1B19K-03        aatggcctgtatttgaacataatgt--gattaccaagtgcaccatgcaca
I6LES1_E1B19K-02        aatggcctgtatttgaacataatgt--gattaccaagtgcaccatgcaca
I6LES1_E1B19K-03        aatggcctgtatttgaacataatgt--gattaccaagtgcaccatgcaca
T2CI10_E1B19K-01        -------------tgaggacaatcttagatta------------------
A0A0K0PX35_E1B19K-      -------------tgaggacaatcttagatta------------------
A0A0K0PX99_E1B19K-      -------------tgaggacaatcttagatta------------------
T1UIP3_E1B19K-01        -------------tgaggacaatcttagatta------------------
J7I6Q4_E1B19K-01        -------------tgaggacaatcttagatta------------------
J7I6S4_E1B19K-01        -------------tgaggacaatcttaaatta------------------
J7ID56_E1B19K-01        -------------tgaggacaatcttagatta------------------
I6LEP5_E1B19K-01        -------------tgaggacaatcttagatta------------------
A0A6M6AA96_E1B19K-      -------------tgaggacaatcttagatta------------------
I6LES1_E1B19K-01        -------------tgaggacaatcttagatta------------------
T1UF50_E1B19K-01        -------------tgaggacaatcttagatta------------------
J7I6W7_E1B19K-02        aatggcctgtttttgatcacaatgt--gttgaccaagtgtaccatgcatg
T1UFS4_E1B19K-02        aatggcctgtttttgatcacaatgt--gttgaccaagtgtaccatgcatg
T1UE63_E1B19K-02        aatggcctgtttttgatcacaatgt--gttgaccaagtgcaccatgcatg
T1UJX4_E1B19K-02        aatggcctgtttttgatcacaatgt--gttgaccaagtgcaccatgcatg
T1UJX4_E1B19K-01        --------------------------------------------------
Q5UW22_E1B19K-01        --------------------------------------------------
T1UE63_E1B19K-01        --------------------------------------------------
J7I6W7_E1B19K-01        --------------------------------------------------
A0A1L7NRH1_E1B19K-      --------------------------------------------------
T1UFS4_E1B19K-01        --------------------------------------------------
                                                                          

T2CI10_E1B19K-02        taggtggtcgcagaggaatgttaatgccataccagtgtaacatgaataat
T1UIP3_E1B19K-02        taggtggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcat
J7I6Q4_E1B19K-02        taggtggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcat
J7I6S4_E1B19K-02        taggtggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcat
J7ID56_E1B19K-02        taggtggtcgcagaggaatgtttatgccttaccagtgtaacatgaatcat
T1UF50_E1B19K-02        taggtggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcat
I6LEP5_E1B19K-02        taggtggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcat
I6LEP5_E1B19K-03        taggtggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcat
I6LES1_E1B19K-02        taggtggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcat
I6LES1_E1B19K-03        taggtggtcgcaggggaatgtttatgccttaccagtgtaacatgaatcat
T2CI10_E1B19K-01        ---------------------------ctggccagtaca-----------
A0A0K0PX35_E1B19K-      ---------------------------ctggccagtgca-----------
A0A0K0PX99_E1B19K-      ---------------------------ctggccagtgca-----------
T1UIP3_E1B19K-01        ---------------------------ctggccagtgca-----------
J7I6Q4_E1B19K-01        ---------------------------ctggccagtgca-----------
J7I6S4_E1B19K-01        ---------------------------ctggccagtgca-----------
J7ID56_E1B19K-01        ---------------------------ctggccagtgca-----------
I6LEP5_E1B19K-01        ---------------------------ctggccagtgca-----------
A0A6M6AA96_E1B19K-      ---------------------------ctggccagtgca-----------
I6LES1_E1B19K-01        ---------------------------ctggccagtgca-----------
T1UF50_E1B19K-01        ---------------------------ctggccagtgca-----------
J7I6W7_E1B19K-02        caggtgggcgtagaggaatgtttatgccttaccagtgtaacatgaatcat
T1UFS4_E1B19K-02        caggtgggcgtagaggaatgtttatgccttaccagtgtaacatgaatcat
T1UE63_E1B19K-02        caggtgggcgtagaggaatgtttatgccttaccagtgtaacatgaatcat
T1UJX4_E1B19K-02        caggtgggcgtagaggaatgtttatgccttaccagtgtaacatgaatcat
T1UJX4_E1B19K-01        ------------------------------gccagtgca-----------
Q5UW22_E1B19K-01        ------------------------------gccagtgca-----------
T1UE63_E1B19K-01        ------------------------------gccagtgca-----------
J7I6W7_E1B19K-01        ------------------------------gccagtgca-----------
A0A1L7NRH1_E1B19K-      ------------------------------gccagtgca-----------
T1UFS4_E1B19K-01        ------------------------------gccagtgca-----------
                                                       *****  *           

T2CI10_E1B19K-02        gtgaaagtgatgttggagccagatgcattttccagaatgagtttaacagg
T1UIP3_E1B19K-02        gtgaaggtgatgttggaaccagatgccttttccagagtaagcttaacagg
J7I6Q4_E1B19K-02        gtgaaggtaatgttggaaccagatgccttttccagagtgagcttaacagg
J7I6S4_E1B19K-02        gtgaaggtaatgttggaaccagatgccttttccagagtgagcttaacagg
J7ID56_E1B19K-02        gtgaaggtgatgttggaaccagatgccttttccagagtgagcttaacagg
T1UF50_E1B19K-02        gtgaaggtgatgttggaaccagatgccttttccagagtgagcttaacagg
I6LEP5_E1B19K-02        gtgaaggtgatgttggaaccagatgccttttccagagtgagcttaacagg
I6LEP5_E1B19K-03        gtgaaggtgatgttggaaccagatgccttttccagagtgagcttaacagg
I6LES1_E1B19K-02        gtgaaggtgatgttggaaccagatgccttttccagagtgagcttaacagg
I6LES1_E1B19K-03        gtgaaggtgatgttggaaccagatgccttttccagagtgagcttaacagg
T2CI10_E1B19K-01        ------------------------gcctc--------tgggcgtagcagg
A0A0K0PX35_E1B19K-      ------------------------gcctc--------tgggcgtagcagg
A0A0K0PX99_E1B19K-      ------------------------gcctc--------tgggcgtagcagg
T1UIP3_E1B19K-01        ------------------------gcctc--------tgggagtagcagg
J7I6Q4_E1B19K-01        ------------------------gcctc--------taggagtagcagg
J7I6S4_E1B19K-01        ------------------------gcctc--------taggagtagcagg
J7ID56_E1B19K-01        ------------------------gcctc--------tgggagtagcagg
I6LEP5_E1B19K-01        ------------------------gcctc--------tgggagtagcagg
A0A6M6AA96_E1B19K-      ------------------------gcctc--------tgggagtagcagg
I6LES1_E1B19K-01        ------------------------gcctc--------tgggagtagcagg
T1UF50_E1B19K-01        ------------------------gcctc--------tgggagtagcagg
J7I6W7_E1B19K-02        gtaaaagtgttgttagaaccagatgccttttccagaatgagtctaacagg
T1UFS4_E1B19K-02        gtgaaagtgttgttggaaccagatgccttttccagaatgagcctaacagg
T1UE63_E1B19K-02        gtgaaagtgttgttggaaccagatgccttttccagaatgagcctaacagg
T1UJX4_E1B19K-02        gtgaaagtgttgttggaaccagatgccttttccagaatgagcctaacagg
T1UJX4_E1B19K-01        ------------------------gcctt--------tgggtgtagcggg
Q5UW22_E1B19K-01        ------------------------gcctt--------tgggtgtagcggg
T1UE63_E1B19K-01        ------------------------gcctt--------tgggtgtagcggg
J7I6W7_E1B19K-01        ------------------------gcctt--------tgggtgtagcggg
A0A1L7NRH1_E1B19K-      ------------------------gcctt--------tgggtgtagcggg
T1UFS4_E1B19K-01        ------------------------gcctt--------tgggtgtagcggg
                                                ** *         *  *  ** * **

T2CI10_E1B19K-02        aatctttgacatgaatctgcaaatatggaagatcctgagatatgatgaca
T1UIP3_E1B19K-02        aatctttgatatgaatattcaactatggaagatcctgagatatgatgaca
J7I6Q4_E1B19K-02        aatctttgatatgaatattcaactatggaagatcctgagatatgatgaca
J7I6S4_E1B19K-02        aatctttgatatgaatattcaactatggaagatcctgagatatgatgaca
J7ID56_E1B19K-02        aatctttgatatgaatattcaactatggaagatcctgagatatgatgaca
T1UF50_E1B19K-02        aatctttgatatgaatattcaactatggaagatcctgagatatgatgaca
I6LEP5_E1B19K-02        aatctttgatatgaatattcaactatggaagatcctgagatatgatgaca
I6LEP5_E1B19K-03        aatctttgatatgaatattcaactatggaagatcctgagatatgatgaca
I6LES1_E1B19K-02        aatctttgatatgaatattcaactatggaagatcctgagatatgatgaca
I6LES1_E1B19K-03        aatctttgatatgaatattcaactatggaagatcctgagatatgatgaca
T2CI10_E1B19K-01        ------------------------------gatcctgagacacccaccga
A0A0K0PX35_E1B19K-      ------------------------------gatcctgagacacccacctg
A0A0K0PX99_E1B19K-      ------------------------------gatcctgagacacccaccgg
T1UIP3_E1B19K-01        ------------------------------gatactgagacacccaccgg
J7I6Q4_E1B19K-01        ------------------------------gatactgagacacccaccga
J7I6S4_E1B19K-01        ------------------------------gatactgagacacccaccga
J7ID56_E1B19K-01        ------------------------------gatactgagacacccaccga
I6LEP5_E1B19K-01        ------------------------------gatactgagacacccaccga
A0A6M6AA96_E1B19K-      ------------------------------gatactgagacacccaccga
I6LES1_E1B19K-01        ------------------------------gatactgagacacccaccga
T1UF50_E1B19K-01        ------------------------------gatactgagacacccaccga
J7I6W7_E1B19K-02        aatgtttgacatgaacatgcaaatctggaagatcctgaggtatgatgata
T1UFS4_E1B19K-02        aatctttgacatgaacatgcaaatctggaagatcctgaggtatgatgata
T1UE63_E1B19K-02        aatctttgacatgaacacgcaaatctggaagatcctgaggtatgatgata
T1UJX4_E1B19K-02        aatctttgacatgaacacgcaaatctggaagatcctgaggtatgatgata
T1UJX4_E1B19K-01        a------------------------------atcctgaggcat-------
Q5UW22_E1B19K-01        a------------------------------atcctgaggcat-------
T1UE63_E1B19K-01        a------------------------------atcctgaggcat-------
J7I6W7_E1B19K-01        a------------------------------atcctgaggcat-------
A0A1L7NRH1_E1B19K-      a------------------------------atcctgaggcat-------
T1UFS4_E1B19K-01        a------------------------------atcctgaggcat-------
                                                       ** *****  *        

T2CI10_E1B19K-02        cgaagtcgagggtacgcgcatgcgagtgcgggggcaaacatgccaggttc
T1UIP3_E1B19K-02        ctaaaccgagggtgcgcgcatgcgaatgcggaggcaagcatgctagattc
J7I6Q4_E1B19K-02        ctaaaccgagggtgcgcgcatgcgaatgcggaggcaagcatgctagattc
J7I6S4_E1B19K-02        ctaaaccgagggtgcgcgcatgcgaatgcggaggcaagcatgctagattc
J7ID56_E1B19K-02        ctaaaccgagggtgcgcgcatgcgaatgcggaggcaagcatgctagattc
T1UF50_E1B19K-02        ctaaaccaagggtgcgcgcatgcgaatgcggaggcaagcatgctagattc
I6LEP5_E1B19K-02        ctaaaccaagggtgcgcgcatgcgaatgcggaggcaagcatgctagattc
I6LEP5_E1B19K-03        ctaaaccaagggtgcgcgcatgcgaatgcggaggcaagcatgctagattc
I6LES1_E1B19K-02        ctaaaccaagggtgcgcgcatgcgaatgcggaggcaagcatgctagattc
I6LES1_E1B19K-03        ctaaaccaagggtgcgcgcatgcgaatgcggaggcaagcatgctagattc
T2CI10_E1B19K-01        ccatgccagcggt-------tttggaggaggag-----------------
A0A0K0PX35_E1B19K-      ccatgccatcggt-------tctggaggaggag-----------------
A0A0K0PX99_E1B19K-      caatgccagcggt-------tctggaggaggag-----------------
T1UIP3_E1B19K-01        ccatgccagcggt-------tctggaggaggag-----------------
J7I6Q4_E1B19K-01        ccatgccagcggt-------tctgcaggaggag-----------------
J7I6S4_E1B19K-01        ccatgccagcggt-------tctgcaggaggag-----------------
J7ID56_E1B19K-01        ccatgccagcggt-------tctgcaggaggag-----------------
I6LEP5_E1B19K-01        ccatgccagcggt-------tctgcaggaggag-----------------
A0A6M6AA96_E1B19K-      ccatgccagcggt-------tctgcaggaggag-----------------
I6LES1_E1B19K-01        ccatgccagcggt-------tctgcaggaggag-----------------
T1UF50_E1B19K-01        ccatgccagcggt-------tctgcaggaggag-----------------
J7I6W7_E1B19K-02        caagatcgagggtgcgcgcatgcgaatgcggaggcaagcatgccaggttc
T1UFS4_E1B19K-02        cgagatcgagggtgcgcgcatgcgaatgcggaggcaagcatgccaggttc
T1UE63_E1B19K-02        cgagatcgagggtgcgcgcatgcgaatgcggaggcaagcatgccaggttc
T1UJX4_E1B19K-02        cgagatcaagggtgcgcacatgcgaatgcggaggcaagcatgccaggttc
T1UJX4_E1B19K-01        -----ccacctgt-------------------------catgccag----
Q5UW22_E1B19K-01        -----ccaccggt-------------------------catgccag----
T1UE63_E1B19K-01        -----ccaccggt-------------------------catgccag----
J7I6W7_E1B19K-01        -----ccaccggt-------------------------catgccag----
A0A1L7NRH1_E1B19K-      -----ccaccggt-------------------------catgccag----
T1UFS4_E1B19K-01        -----ccaccggt-------------------------catgccag----
                              *    **                                     

T2CI10_E1B19K-02        cagccggtgtgtgtggatgtgactgaagaactaaggccagatcatttggt
T1UIP3_E1B19K-02        cagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggt
J7I6Q4_E1B19K-02        cagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggt
J7I6S4_E1B19K-02        cagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggt
J7ID56_E1B19K-02        cagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggt
T1UF50_E1B19K-02        cagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggt
I6LEP5_E1B19K-02        cagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggt
I6LEP5_E1B19K-03        cagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggt
I6LES1_E1B19K-02        cagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggt
I6LES1_E1B19K-03        cagccggtgtgcgtggatgtgactgaagacctgagacccgatcatttggt
T2CI10_E1B19K-01        caccaagag---------------gacaatccgagagtcg----------
A0A0K0PX35_E1B19K-      cagcaggag---------------gacaatccgagagccg----------
A0A0K0PX99_E1B19K-      cagcaggag---------------gacaatccgagagccg----------
T1UIP3_E1B19K-01        cagcaggag---------------gacaatccgagagccg----------
J7I6Q4_E1B19K-01        cagcaggag---------------gacaatccgagagccg----------
J7I6S4_E1B19K-01        cagcaggag---------------gacaatccgagagccg----------
J7ID56_E1B19K-01        cagcaggag---------------gacaatccgagagccg----------
I6LEP5_E1B19K-01        cagcaggag---------------gacaatccgagagccg----------
A0A6M6AA96_E1B19K-      cagcaggag---------------gacaatccgagagccg----------
I6LES1_E1B19K-01        cagcaggag---------------gacaatccgagagccg----------
T1UF50_E1B19K-01        cagcaggag---------------gacaatccgagagccg----------
J7I6W7_E1B19K-02        caaccggtgtgtgtagatgtgactgaagatctgagaccggatcatttggt
T1UFS4_E1B19K-02        cagccggtgtgtgtagatgtgactgaagatctgagaccggatcatttggt
T1UE63_E1B19K-02        cagccggtgtgtgtagatgtgaccgaagatctcagaccggatcatttggt
T1UJX4_E1B19K-02        cagccggtgtgtgtagatgtgacggaagatctcagaccggatcatttggt
T1UJX4_E1B19K-01        ----cggt---------tctggaggaggaacagcaagaggacaatccg--
Q5UW22_E1B19K-01        ----cggt---------tctggaggaggaacagcaagaggacaacccg--
T1UE63_E1B19K-01        ----cggt---------tctggaggaggaacagcaagaggacaacccg--
J7I6W7_E1B19K-01        ----cggt---------tctggaggaggaacagcaagaggacaacccg--
A0A1L7NRH1_E1B19K-      ----cggt---------tctggaggaggaacagcaagaggacaacccg--
T1UFS4_E1B19K-01        ----cggt---------tctggaggaggaacagcaagaggacaacccg--
                              *                 **  * *        *          

T2CI10_E1B19K-02        gattgcctgcactggagcggagttcggttctagtggtgaagaaactgact
T1UIP3_E1B19K-02        gcttgcctgcactggagcggagttcggttctagtggtgaagaaactgact
J7I6Q4_E1B19K-02        gcttgcctgcactggagcggagttcggttccagtggtgaagaaactgact
J7I6S4_E1B19K-02        gcttgcctgcactggagcggagttcggttccagtggtgaagaaactgact
J7ID56_E1B19K-02        gcttgcctgcactggagcggagtttggttctagtggtgaagaaactgact
T1UF50_E1B19K-02        gcttgcctgcactggagcggagtttggttctagtggtgaagaaactgact
I6LEP5_E1B19K-02        gcttgcctgcactggagcggagtttggttctagtggtgaagaaactgact
I6LEP5_E1B19K-03        gcttgcctgcactggagcggagtttggttctagtggtgaagaaactgact
I6LES1_E1B19K-02        gcttgcctgcactggagcggagtttggttctagtggtgaagaaactgact
I6LES1_E1B19K-03        gcttgcctgcactggagcggagtttggttctagtggtgaagaaactgact
T2CI10_E1B19K-01        ----gcctggacc--------ctccggtggaggaggcggag-----gagt
A0A0K0PX35_E1B19K-      ----gcctggacc--------ctccggtggaggaggcggag-----gagt
A0A0K0PX99_E1B19K-      ----gcctggacc--------ctccggtggaggaggcggag-----gagt
T1UIP3_E1B19K-01        ----gcctggacc--------ctccggt---------ggag-----gagt
J7I6Q4_E1B19K-01        ----gcctggacc--------ctccggt---------ggag-----gagt
J7I6S4_E1B19K-01        ----gcctggacc--------ctccggt---------ggag-----gagt
J7ID56_E1B19K-01        ----gcctggacc--------ctccggt---------ggag-----gagt
I6LEP5_E1B19K-01        ----gcctggacc--------ctccggt---------ggag-----gagt
A0A6M6AA96_E1B19K-      ----gcctggacc--------ctccggt---------ggag-----gagt
I6LES1_E1B19K-01        ----gcctggacc--------ctccggt---------ggag-----gagt
T1UF50_E1B19K-01        ----gcctggacc--------ctccggt---------ggag-----gagt
J7I6W7_E1B19K-02        tattgcccgcactggagcagagttcggatccagtggagaagaaactgact
T1UFS4_E1B19K-02        tattgcccgcactggagcagagtttggatccagtggagaagaaactgact
T1UE63_E1B19K-02        tattgcccgcactggagcagagttcggatccagtggagaagaaactgact
T1UJX4_E1B19K-02        tattgcccgcactggagcagagttcggatccagtggagaagaaactgact
T1UJX4_E1B19K-01        -agagccggc-ctggacc---------ctccagtggag--gaggcggagt
Q5UW22_E1B19K-01        -agagccggc-ctggacc---------ctccagtggag--gaggcggagt
T1UE63_E1B19K-01        -agagccggc-ctggacc---------ctccagtggag--gaggcggagt
J7I6W7_E1B19K-01        -agagccggc-ctggacc---------ctccagtggag--gaggcggagt
A0A1L7NRH1_E1B19K-      -agagccggc-ctggacc---------ctccagtggag--gaggcggagt
T1UFS4_E1B19K-01        -agagccggc-ctggacc---------ctccagtggag--gaggcggagt
                            *** *  *                         *  *     ** *

T2CI10_E1B19K-02        aa
T1UIP3_E1B19K-02        aa
J7I6Q4_E1B19K-02        aa
J7I6S4_E1B19K-02        aa
J7ID56_E1B19K-02        aa
T1UF50_E1B19K-02        aa
I6LEP5_E1B19K-02        aa
I6LEP5_E1B19K-03        aa
I6LES1_E1B19K-02        aa
I6LES1_E1B19K-03        aa
T2CI10_E1B19K-01        ag
A0A0K0PX35_E1B19K-      ag
A0A0K0PX99_E1B19K-      ag
T1UIP3_E1B19K-01        ag
J7I6Q4_E1B19K-01        ag
J7I6S4_E1B19K-01        ag
J7ID56_E1B19K-01        ag
I6LEP5_E1B19K-01        ag
A0A6M6AA96_E1B19K-      ag
I6LES1_E1B19K-01        ag
T1UF50_E1B19K-01        ag
J7I6W7_E1B19K-02        aa
T1UFS4_E1B19K-02        aa
T1UE63_E1B19K-02        aa
T1UJX4_E1B19K-02        aa
T1UJX4_E1B19K-01        ag
Q5UW22_E1B19K-01        ag
T1UE63_E1B19K-01        ag
J7I6W7_E1B19K-01        ag
A0A1L7NRH1_E1B19K-      ag
T1UFS4_E1B19K-01        ag
                        * 

© 1998-2022Legal notice