Dataset for CDS adenoviridae of organism Human adenovirus D serotype 8

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1P8C849_E1B19K-      atggagccaggacacccaactaagcaggggctacattctggactttgc-a
A0A1P7YYY5_E1B19K-      atggagccaggacacccaactaagcaggggctacattctggactttgc-a
A0A1P7YWR9_E1B19K-      atggagccaggacacccaactaagcaggggctacattctggactttgc-a
A0A1P7YXN8_E1B19K-      atggagccaggacacccaactaagcaggggctacattctggactttgc-a
A0A1P7YWY2_E1B19K-      atggagccaggacacccaactaagcaggggctacattctggactttgc-a
A0A1P7YYY5_E1B19K-      atgga---------------tgtgtggagtattcttggggaatttaacaa
A0A1P7YWY2_E1B19K-      atgga---------------tgtgtggagtattcttggggaatttaacaa
A0A1P7YWR9_E1B19K-      atgga---------------tgtgtggagtattcttggggaatttaacaa
A0A1P7YXN8_E1B19K-      atgga---------------tgtgtggagtattcttggggaatttaacaa
A0A1P8C849_E1B19K-      atgga---------------tgtgtggagtattcttggggaatttaacaa
B9A5A7_E1B19K-01        atgga---------------tgtgtggagtattcttggggaatttaacaa
                        *****               *  *  * *  * * *   * * **  * *

A0A1P8C849_E1B19K-      gccatgc--acctgtggagggcctggatgaggcagcggggacagagaatc
A0A1P7YYY5_E1B19K-      gccatgc--acctgtggagggcctggatgaggcagcggggacagagaatc
A0A1P7YWR9_E1B19K-      gccatgc--acctgtggagggcctggatgaggcagcggggacagagaatc
A0A1P7YXN8_E1B19K-      gccatgc--acctgtggagggcctggatgaggcagcggggacagagaatc
A0A1P7YWY2_E1B19K-      gccatgc--acctgtggagggcctggatgaggcagcggggacagagaatc
A0A1P7YYY5_E1B19K-      gacacgccggcttgtgga--------------------ggatag------
A0A1P7YWY2_E1B19K-      gacacgccggcttgtgga--------------------ggatag------
A0A1P7YWR9_E1B19K-      gacacgccggcttgtgga--------------------ggatag------
A0A1P7YXN8_E1B19K-      gacacgccggcttgtgga--------------------ggatag------
A0A1P8C849_E1B19K-      gacacgccggcttgtgga--------------------ggatag------
B9A5A7_E1B19K-01        gacacgccggcttgtgga--------------------ggatag------
                        * ** **   * ******                    *** **      

A0A1P8C849_E1B19K-      ttgaactactggcttctacagccagcagctttgggtcttcttcatctaca
A0A1P7YYY5_E1B19K-      ttgaactactggcttctacagccagcagcttcgggtcttcttcatctaca
A0A1P7YWR9_E1B19K-      ttgaactactggcttctacagccagcagcttcgggtcttcttcatctaca
A0A1P7YXN8_E1B19K-      ttgaactactggcttctacagccagcagcttcgggtcttcttcatctaca
A0A1P7YWY2_E1B19K-      ttgaactactggcttctacagccagcagcttcgggtcttcttcatctaca
A0A1P7YYY5_E1B19K-      ----------------ttcagacgggtgctccgggtttt-----------
A0A1P7YWY2_E1B19K-      ----------------ttcagacgggtgctccgggtttt-----------
A0A1P7YWR9_E1B19K-      ----------------ttcagacgggtgctccgggtttt-----------
A0A1P7YXN8_E1B19K-      ----------------ttcagacgggtgctccgggtttt-----------
A0A1P8C849_E1B19K-      ----------------ttcagacgggtgctccgggtttt-----------
B9A5A7_E1B19K-01        ----------------ttcagacgggtgctccgggtttt-----------
                                        * *** * *  ***  **** **           

A0A1P8C849_E1B19K-      cagacaaacatccatgttggaggaagaaatgagggaggccatggacaaga
A0A1P7YYY5_E1B19K-      cagacaaacatccatgttggaggaagaaataagggaggccatggacaaga
A0A1P7YWR9_E1B19K-      cagacaaacatccatgttggaggaagaaatgagggaggccatggacaaga
A0A1P7YXN8_E1B19K-      cagacaaacatccatgttggaggaagaaatgagggaggccatggacaaga
A0A1P7YWY2_E1B19K-      cagacaaacatccatgttggaggaagaaatgagggagtccatggacaaga
A0A1P7YYY5_E1B19K-      ---------------------------------ggagacactggtttgga
A0A1P7YWY2_E1B19K-      ---------------------------------ggagacactggtttgga
A0A1P7YWR9_E1B19K-      ---------------------------------ggagacactggtttgga
A0A1P7YXN8_E1B19K-      ---------------------------------ggagacactggtttgga
A0A1P8C849_E1B19K-      ---------------------------------ggagacactggtttgga
B9A5A7_E1B19K-01        ---------------------------------ggagacactggtttgga
                                                         **** *  ***    **

A0A1P8C849_E1B19K-      acccgaggagcggcctggaccctccgtcggaagaggagctggattaaatg
A0A1P7YYY5_E1B19K-      acccgaggagcggcctggaccctccgttggaagaggagctggattaaatg
A0A1P7YWR9_E1B19K-      acccgaggagcggcctggaccctccgtcggaagaggagctggattaaatg
A0A1P7YXN8_E1B19K-      acccgaggagcggcctggaccctccgtcggaagaggagctggattaaatg
A0A1P7YWY2_E1B19K-      acccgaggagcggcctggaccctccgtcggaagaggagctggattaaatg
A0A1P7YYY5_E1B19K-      ac-----------------tcctc--------------------------
A0A1P7YWY2_E1B19K-      ac-----------------tcctc--------------------------
A0A1P7YWR9_E1B19K-      ac-----------------tcctc--------------------------
A0A1P7YXN8_E1B19K-      ac-----------------tcctc--------------------------
A0A1P8C849_E1B19K-      ac-----------------tcctc--------------------------
B9A5A7_E1B19K-01        ac-----------------tcctc--------------------------
                        **                  ****                          

A0A1P8C849_E1B19K-      aggtatccagcctatacccagagcttagcaaggtgctgacatccatggcc
A0A1P7YYY5_E1B19K-      aggtatccagcctatacccagagcttagcaaggtgctgacatccatggcc
A0A1P7YWR9_E1B19K-      aggtatccagcctatacccagagcttagcaaggtgctgacatccatggcc
A0A1P7YXN8_E1B19K-      aggtatccagcctatacccagagcttagcaaggtgctgacatccatggcc
A0A1P7YWY2_E1B19K-      aggtatccagcctatacccagagcttagcaaggtgctgacatccatggcc
A0A1P7YYY5_E1B19K-      ---tatctcgcct------------------ggtgtacac----------
A0A1P7YWY2_E1B19K-      ---tatctcgcct------------------ggtgtacac----------
A0A1P7YWR9_E1B19K-      ---tatctcgcct------------------ggtgtacac----------
A0A1P7YXN8_E1B19K-      ---tatctcgcct------------------ggtgtacac----------
A0A1P8C849_E1B19K-      ---tatctcgcct------------------ggtgtacac----------
B9A5A7_E1B19K-01        ---tatctcgcct------------------ggtgtacac----------
                           ****  ****                  ****   **          

A0A1P8C849_E1B19K-      aggggagtgaagagggagaggagcgatgggggcaatactgggctgatgac
A0A1P7YYY5_E1B19K-      aggggagtgaagagggagaggagcgatgggggcaatactgggctgatgac
A0A1P7YWR9_E1B19K-      aggggagtgaagagggagaggagcgatgggggcaatactgggctgatgac
A0A1P7YXN8_E1B19K-      aggggagtgaagagggagaggagcgatgggggcaatactgggctgatgac
A0A1P7YWY2_E1B19K-      aggggagtgaagagggagaggagcgatgggggcaatactgggctgatgac
A0A1P7YYY5_E1B19K-      -----agttaagaaggattatagcgaggaatttgaaa--------atctt
A0A1P7YWY2_E1B19K-      -----agttaagaaggattatagcgaggaatttgaaa--------atatt
A0A1P7YWR9_E1B19K-      -----agttaagaaggattatagcgaggaatttgaaa--------atatt
A0A1P7YXN8_E1B19K-      -----agttaagaaggattatagcgaggaatttgaaa--------atatt
A0A1P8C849_E1B19K-      -----agttaagaaggattatagcgaggaatttgaaa--------atctt
B9A5A7_E1B19K-01        -----agttaagaaggattatagcgaggaatttgaaa--------atctt
                             *** **** ***    ***** *      * *        **   

A0A1P8C849_E1B19K-      ccagctaactgccagcctaatgaatcgcaagcgcccagagcgtattacct
A0A1P7YYY5_E1B19K-      ccagctaactgccagcctaatgaatcgcaagcgcccagagcgtattacct
A0A1P7YWR9_E1B19K-      ccagctaactgccagcctaatgaatcgcaagcgcccagagcgtattacct
A0A1P7YXN8_E1B19K-      ccagctaactgccagcctaatgaatcgcaagcgcccagagcgtattacct
A0A1P7YWY2_E1B19K-      ccagctaactgccagcctaatgaatcgcaagcgcccagagcgtattacct
A0A1P7YYY5_E1B19K-      tttgccgactgc--------------------------------------
A0A1P7YWY2_E1B19K-      tttgccgactgc--------------------------------------
A0A1P7YWR9_E1B19K-      tttgccgactgc--------------------------------------
A0A1P7YXN8_E1B19K-      tttgccgactgc--------------------------------------
A0A1P8C849_E1B19K-      tttgccgactgc--------------------------------------
B9A5A7_E1B19K-01        tttgccgactgc--------------------------------------
                           **  *****                                      

A0A1P8C849_E1B19K-      ggcacgagctacagcaggagtgcagggatgagataggtctgatgcaggat
A0A1P7YYY5_E1B19K-      ggcacgagctacagcaggagtgcagggatgagataggcctgatgcaggat
A0A1P7YWR9_E1B19K-      ggcacgagctacagcaggagtgcagggatgagataggcctgatgcaggat
A0A1P7YXN8_E1B19K-      ggcacgagctacagcaggagtgcagggatgagataggcctgatgcaggat
A0A1P7YWY2_E1B19K-      ggcacgagctacagcaggagtgcagggatgagataggcctgatgcaggat
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------

A0A1P8C849_E1B19K-      aaatatggcctggagcaaataaaaacccattggttgaacccagacgagga
A0A1P7YYY5_E1B19K-      aaatatggcctggagcaaataaaaacccattggttgaacccagacgagga
A0A1P7YWR9_E1B19K-      aaatatggcctggagcaaataaaaacccattggttgaacccagacgagga
A0A1P7YXN8_E1B19K-      aaatatggcctggagcaaataaaaacccattggttgaacccagacgagga
A0A1P7YWY2_E1B19K-      aaatatggcctggagcaaataaaaacccattggttgaacccagacgagga
A0A1P7YYY5_E1B19K-      ---tctggcctg--------------------------------------
A0A1P7YWY2_E1B19K-      ---tcttgcctg--------------------------------------
A0A1P7YWR9_E1B19K-      ---tctggcctg--------------------------------------
A0A1P7YXN8_E1B19K-      ---tcttgcctg--------------------------------------
A0A1P8C849_E1B19K-      ---tctggcctg--------------------------------------
B9A5A7_E1B19K-01        ---tctggcctg--------------------------------------
                           * * *****                                      

A0A1P8C849_E1B19K-      ttgggaggaggccattaagaaatatgccaagatagccctgcgcccagatt
A0A1P7YYY5_E1B19K-      ttgggaggaggccattaagaaatatgccaagatagccctgcgcccagatt
A0A1P7YWR9_E1B19K-      ttgggaggaggccattaagaaatatgccaagatagccctgcgcccagatt
A0A1P7YXN8_E1B19K-      ttgggaggaggccattaagaaatatgccaagatagccctgcgcccagatt
A0A1P7YWY2_E1B19K-      ttgggaggaggccattaagaaatatgccaagatagccctgcgcccagatt
A0A1P7YYY5_E1B19K-      -------------------------------------------ctagatt
A0A1P7YWY2_E1B19K-      -------------------------------------------ctagatt
A0A1P7YWR9_E1B19K-      -------------------------------------------ctagatt
A0A1P7YXN8_E1B19K-      -------------------------------------------ctagatt
A0A1P8C849_E1B19K-      -------------------------------------------ctagatt
B9A5A7_E1B19K-01        -------------------------------------------ctagatt
                                                                   * *****

A0A1P8C849_E1B19K-      gcaagtacagggtgactaagaccgtgaatattaaacatgcctgctacatc
A0A1P7YYY5_E1B19K-      gcaagtacagggtgactaagaccgtgaatattaaacatgcctgctacatc
A0A1P7YWR9_E1B19K-      gcaagtacagggtgactaagaccgtgaatattaaacatgcctgctacatc
A0A1P7YXN8_E1B19K-      gcaagtacagggtgactaagaccgtgaatattaaacatgcctgctacatc
A0A1P7YWY2_E1B19K-      gcaagtacagggtgactaagaccgtgaatattaaacatgcctgctacatc
A0A1P7YYY5_E1B19K-      ---------------------ctttaaattttggcca--ccagtcccttt
A0A1P7YWY2_E1B19K-      ---------------------ctttaaattttggcca--ccagtcccttt
A0A1P7YWR9_E1B19K-      ---------------------ctttaaattttggcca--ccagtcccttt
A0A1P7YXN8_E1B19K-      ---------------------ctttaaattttggcca--ccagtcccttt
A0A1P8C849_E1B19K-      ---------------------ctttaaattttggcca--ccagtcccttt
B9A5A7_E1B19K-01        ---------------------ctttaaattttggcca--ccagtcccttt
                                             *  * *** **   **  ** *   * * 

A0A1P8C849_E1B19K-      tcggggaacggggcagaggtggacatcgatactctggacaagtcagcctt
A0A1P7YYY5_E1B19K-      tcggggaacggggcagaggtggacatcgatactctggacaagtcagcctt
A0A1P7YWR9_E1B19K-      tcggggaacggggcagaggtggacatcgatactctggacaagtcagcctt
A0A1P7YXN8_E1B19K-      tcggggaacggggcagaggtggacatcgatactctggacaagtcagcctt
A0A1P7YWY2_E1B19K-      tcggggaacggggcagaggtggacatcgatactctggacaagtcagcctt
A0A1P7YYY5_E1B19K-      tccaggaaaggg-----------------tactcca-------cagcct-
A0A1P7YWY2_E1B19K-      tccaggaaaggg-----------------tactcca-------cagcct-
A0A1P7YWR9_E1B19K-      tccaggaaaggg-----------------tactcca-------cagcct-
A0A1P7YXN8_E1B19K-      tccaggaaaggg-----------------tactcca-------cagcct-
A0A1P8C849_E1B19K-      tccaggaaaggg-----------------tactcca-------cagcct-
B9A5A7_E1B19K-01        tccaggaaaggg-----------------tactcca-------cagcct-
                        **  **** ***                 *****         ****** 

A0A1P8C849_E1B19K-      taggtgttgcatgatgggaatgagagcaggagtaatgaatatgaattcca
A0A1P7YYY5_E1B19K-      caggtgttgcatgatgggaatgagagcaggagtaatgaatatgaattcca
A0A1P7YWR9_E1B19K-      caggtgttgcatgatgggaatgagagcaggagtaatgaatatgaattcca
A0A1P7YXN8_E1B19K-      caggtgttgcatgatgggaatgagagcaggagtaatgaatatgaattcca
A0A1P7YWY2_E1B19K-      caggtgttgcatgatgggaatgagagcaggagtaatgaatatgaattcca
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------

A0A1P8C849_E1B19K-      tgatctttataaacataaagttcaatggagagaagtttaatggggtactg
A0A1P7YYY5_E1B19K-      tgatctttataaacataaagttcaatggagagaagtttaatggggtactg
A0A1P7YWR9_E1B19K-      tgatctttataaacataaagttcaatggagagaagtttaatggggtactg
A0A1P7YXN8_E1B19K-      tgatctttataaacataaagttcaatggagagaagtttaatggggtactg
A0A1P7YWY2_E1B19K-      tgatctttataaacataaagttcaatggagagaagtttaatggggtactg
A0A1P7YYY5_E1B19K-      tgatttttccagcc------------------------cagggcgcact-
A0A1P7YWY2_E1B19K-      tgatttttccagcc------------------------cagggcgcact-
A0A1P7YWR9_E1B19K-      tgatttttccagcc------------------------cagggcgcact-
A0A1P7YXN8_E1B19K-      tgatttttccagcc------------------------cagggcgcact-
A0A1P8C849_E1B19K-      tgatttttccagcc------------------------cagggcgcact-
B9A5A7_E1B19K-01        tgatttttccagcc------------------------cagggcgcact-
                        **** ***  *  *                         * ** * *** 

A0A1P8C849_E1B19K-      tttatggccaatagccacatgaccctgcatggttgcagtttttttggctt
A0A1P7YYY5_E1B19K-      tttatggccaacagccacatgaccctgcatggttgcagtttttttggctt
A0A1P7YWR9_E1B19K-      tttatggccaacagccacatgaccctgcatggttgcagtttttttggctt
A0A1P7YXN8_E1B19K-      tttatggccaacagccacatgaccctgcatggttgcagtttttttggctt
A0A1P7YWY2_E1B19K-      tttatggccaacagccacatgaccctgcatggttgcagtttttttggctt
A0A1P7YYY5_E1B19K-      ----------acagc------------cggggttgc---ttttgtggttt
A0A1P7YWY2_E1B19K-      ----------acagc------------cggggttgc---ttttgtggttt
A0A1P7YWR9_E1B19K-      ----------acagc------------cggggttgc---ttttgtggttt
A0A1P7YXN8_E1B19K-      ----------acagc------------cggggttgc---ttttgtggttt
A0A1P8C849_E1B19K-      ----------acagc------------cggggttgc---ttttgtggttt
B9A5A7_E1B19K-01        ----------acagc------------cggggttgc---ttttgtggttt
                                  * ***            *  ******   **** *** **

A0A1P8C849_E1B19K-      taacaatatgtgtgcagaggtctggggtgctgctaagattaggggatgta
A0A1P7YYY5_E1B19K-      taacaatatgtgtgcagaggtctggggtgctgctaagattaggggatgta
A0A1P7YWR9_E1B19K-      taacaatatgtgtgcagaggtctggggtgctgctaagattaggggatgta
A0A1P7YXN8_E1B19K-      taacaatatgtgtgcagaggtctggggtgctgctaagattaggggatgta
A0A1P7YWY2_E1B19K-      taacaatatgtgtgcagaggtctggggtgctgctaagattaggggatgta
A0A1P7YYY5_E1B19K-      t-------------------------------------------------
A0A1P7YWY2_E1B19K-      t-------------------------------------------------
A0A1P7YWR9_E1B19K-      t-------------------------------------------------
A0A1P7YXN8_E1B19K-      t-------------------------------------------------
A0A1P8C849_E1B19K-      t-------------------------------------------------
B9A5A7_E1B19K-01        t-------------------------------------------------

A0A1P8C849_E1B19K-      agttttacggctgctggatgggcgtggttggaagacccaagagcgagatg
A0A1P7YYY5_E1B19K-      agttttacggctgctggatgggcgtggttggaagacccaagagcgagatg
A0A1P7YWR9_E1B19K-      agttttacggctgctggatgggcgtggttggaagacccaagagcgagatg
A0A1P7YXN8_E1B19K-      agttttacggctgctggatgggcgtggttggaagacccaagagcgagatg
A0A1P7YWY2_E1B19K-      agttttacggctgctggatgggcgtggttggaagacccaagagcgagatg
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------

A0A1P8C849_E1B19K-      tctgtaaagcagtgtgtgtttgaaaaatgctacctgggagtctgtaccga
A0A1P7YYY5_E1B19K-      tctgtaaagcagtgtgtgtttgaaaaatgctacctgggagtctgtaccga
A0A1P7YWR9_E1B19K-      tctgtaaagcagtgtgtgtttgaaaaatgctacctgggagtctgtaccga
A0A1P7YXN8_E1B19K-      tctgtaaagcagtgtgtgtttgaaaaatgctacctgggagtctgtaccga
A0A1P7YWY2_E1B19K-      tctgtaaagcagtgtgtgtttgaaaaatgctacctgggagtctgtaccga
A0A1P7YYY5_E1B19K-      --------------tttggttgacaaat--------ggagcc--------
A0A1P7YWY2_E1B19K-      --------------tttggttgacaaat--------ggagcc--------
A0A1P7YWR9_E1B19K-      --------------tttggttgacaaat--------ggagcc--------
A0A1P7YXN8_E1B19K-      --------------tttggttgacaaat--------ggagcc--------
A0A1P8C849_E1B19K-      --------------tttggttgacaaat--------ggagcc--------
B9A5A7_E1B19K-01        --------------tttggttgacaaat--------ggagcc--------
                                      * ** **** ****        **** *        

A0A1P8C849_E1B19K-      gggcaatgctagagtaagacactgctcttccctagagacgggctgctttt
A0A1P7YYY5_E1B19K-      gggcaatgctagagtaagacactgctcttccctagagacgggctgctttt
A0A1P7YWR9_E1B19K-      gggcaatgctagagtaagacactgctcttccctagagacgggctgctttt
A0A1P7YXN8_E1B19K-      gggcaatgctagagtaagacactgctcttccctagagacgggctgctttt
A0A1P7YWY2_E1B19K-      gggcaatgctagagtaagacactgctcttccctagagacgggctgctttt
A0A1P7YYY5_E1B19K-      --------------------------------------------------
A0A1P7YWY2_E1B19K-      --------------------------------------------------
A0A1P7YWR9_E1B19K-      --------------------------------------------------
A0A1P7YXN8_E1B19K-      --------------------------------------------------
A0A1P8C849_E1B19K-      --------------------------------------------------
B9A5A7_E1B19K-01        --------------------------------------------------

A0A1P8C849_E1B19K-      gcctggtgaagggcacagcctcgattaagcataatgtggtaaagggctgc
A0A1P7YYY5_E1B19K-      gcctggtgaagggcacagcctcgattaagcataatgtggtaaagggctgc
A0A1P7YWR9_E1B19K-      gcctggtgaagggcacagcctcgattaagcataatgtggtaaagggctgc
A0A1P7YXN8_E1B19K-      gcctggtgaagggcacagcctcgattaagcataatgtggtaaagggctgc
A0A1P7YWY2_E1B19K-      gcctggtgaagggcacagcctcgattaagcataatgtggtaaagggctgc
A0A1P7YYY5_E1B19K-      ---------aggaca----cccaactaagc-----------aggggct--
A0A1P7YWY2_E1B19K-      ---------aggaca----cccaactaagc-----------aggggct--
A0A1P7YWR9_E1B19K-      ---------aggaca----cccaactaagc-----------aggggct--
A0A1P7YXN8_E1B19K-      ---------aggaca----cccaactaagc-----------aggggct--
A0A1P8C849_E1B19K-      ---------aggaca----cccaactaagc-----------aggggct--
B9A5A7_E1B19K-01        ---------aggaca----cccaactaagc-----------aggggct--
                                 *** **    * * * *****           * *****  

A0A1P8C849_E1B19K-      acggatgagcgcatgtacaacatgctgacctgcgactcgggggtctgcca
A0A1P7YYY5_E1B19K-      acggatgagcgcatgtacaacatgctgacctgcgactcgggggtctgcca
A0A1P7YWR9_E1B19K-      acggatgagcgcatgtacaacatgctgacctgcgactcgggggtctgcca
A0A1P7YXN8_E1B19K-      acggatgagcgcatgtacaacatgctgacctgcgactcgggggtctgcca
A0A1P7YWY2_E1B19K-      acggatgagcgcatgtacaacatgctgacctgcgactcgggggtctgcca
A0A1P7YYY5_E1B19K-      -------------------acattctggactttg----------------
A0A1P7YWY2_E1B19K-      -------------------acattctggactttg----------------
A0A1P7YWR9_E1B19K-      -------------------acattctggactttg----------------
A0A1P7YXN8_E1B19K-      -------------------acattctggactttg----------------
A0A1P8C849_E1B19K-      -------------------acattctggactttg----------------
B9A5A7_E1B19K-01        -------------------acattctggactttg----------------
                                           **** ***  **  *                

A0A1P8C849_E1B19K-      tatcctgaagaacatccatgtgacctcccaccccagaaaaaagtggccag
A0A1P7YYY5_E1B19K-      tatcctgaagaacatgcatgtgacctcccaccccagaaaaaagtggccag
A0A1P7YWR9_E1B19K-      tatcctgaagaacatccatgtgacctcccaccccagaaaaaagtggccag
A0A1P7YXN8_E1B19K-      tatcctgaagaacatccatgtgacctcccaccccagaaaaaagtggccag
A0A1P7YWY2_E1B19K-      tatcctgaagaacatccatgtgacctcccaccccagaaaaaagtggccag
A0A1P7YYY5_E1B19K-      ------------cagccatgc-----------------------------
A0A1P7YWY2_E1B19K-      ------------cagccatgc-----------------------------
A0A1P7YWR9_E1B19K-      ------------cagccatgc-----------------------------
A0A1P7YXN8_E1B19K-      ------------cagccatgc-----------------------------
A0A1P8C849_E1B19K-      ------------cagccatgc-----------------------------
B9A5A7_E1B19K-01        ------------cagccatgc-----------------------------
                                    **  ****                              

A0A1P8C849_E1B19K-      tgtttgagaataacctgctgattaagtgccatatgcacctgggtgccaga
A0A1P7YYY5_E1B19K-      tgtttgagaataacctgctgattaagtgccatatgcacctgggtgccaga
A0A1P7YWR9_E1B19K-      tgtttgagaataacctgctgattaagtgccatatgcacctgggtgccaga
A0A1P7YXN8_E1B19K-      tgtttgagaataacctgctgattaagtgccatatgcacctgggtgccaga
A0A1P7YWY2_E1B19K-      tgtttgagaataacctgctgattaagtgccatatgcacctgggtgccaga
A0A1P7YYY5_E1B19K-      ------------acctgtgga-------------gggcctggatg-----
A0A1P7YWY2_E1B19K-      ------------acctgtgga-------------gggcctggatg-----
A0A1P7YWR9_E1B19K-      ------------acctgtgga-------------gggcctggatg-----
A0A1P7YXN8_E1B19K-      ------------acctgtgga-------------gggcctggatg-----
A0A1P8C849_E1B19K-      ------------acctgtgga-------------gggcctggatg-----
B9A5A7_E1B19K-01        ------------acctgtgga-------------gggcctggatg-----
                                    *****  **             *  ***** **     

A0A1P8C849_E1B19K-      aggggcaccttccagccgtaccagtgcaactttagccagaccaagctgct
A0A1P7YYY5_E1B19K-      aggggcaccttccagccgtaccagtgcaactttagccagaccaagctgct
A0A1P7YWR9_E1B19K-      aggggcaccttccagccgtaccagtgcaactttagccagaccaagctgct
A0A1P7YXN8_E1B19K-      aggggcaccttccagccgtaccagtgcaactttagccagaccaagctgct
A0A1P7YWY2_E1B19K-      aggggcaccttccagccgtaccagtgcaactttagccagaccaagctgct
A0A1P7YYY5_E1B19K-      agg---------cagcggggacagagaatcttgaacta------------
A0A1P7YWY2_E1B19K-      agg---------cagcggggacagagaatcttgaacta------------
A0A1P7YWR9_E1B19K-      agg---------cagcggggacagagaatcttgaacta------------
A0A1P7YXN8_E1B19K-      agg---------cagcggggacagagaatcttgaacta------------
A0A1P8C849_E1B19K-      agg---------cagcggggacagagaatcttgaacta------------
B9A5A7_E1B19K-01        agg---------cagcggggacagagaatcttgaacta------------
                        ***         **** *   *** * * *** * * *            

A0A1P8C849_E1B19K-      gttggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
A0A1P7YYY5_E1B19K-      gttggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
A0A1P7YWR9_E1B19K-      gttggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
A0A1P7YXN8_E1B19K-      gttggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
A0A1P7YWY2_E1B19K-      gttggagaacgatgccttctccagggtgaacctgaacggcatctttgaca
A0A1P7YYY5_E1B19K-      -----------ctggcttctacag-----------ccagcagcttcg---
A0A1P7YWY2_E1B19K-      -----------ctggcttctacag-----------ccagcagcttcg---
A0A1P7YWR9_E1B19K-      -----------ctggcttctacag-----------ccagcagcttcg---
A0A1P7YXN8_E1B19K-      -----------ctggcttctacag-----------ccagcagcttcg---
A0A1P8C849_E1B19K-      -----------ctggcttctacag-----------ccagcagctttg---
B9A5A7_E1B19K-01        -----------ctggcttctacag-----------ccagcagcttcg---
                                    ** ***** ***            * *** *** *   

A0A1P8C849_E1B19K-      tggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtccag
A0A1P7YYY5_E1B19K-      tggatgtgtcggtgtacaagatcctgagatacgatgagaccaa-gtccag
A0A1P7YWR9_E1B19K-      tggatgtgtcggtgtacaagatcctgagatacgatgagaccaa-gtccag
A0A1P7YXN8_E1B19K-      tggatgtgtcggtgtacaagatcctgagatacgatgagaccaa-gtccag
A0A1P7YWY2_E1B19K-      tggatgtgtcggtgtacaagatcctgagatacgatgagaccaa-gtccag
A0A1P7YYY5_E1B19K-      -ggtcttcttcatctacac-----------------agacaaacatccat
A0A1P7YWY2_E1B19K-      -ggtcttcttcatctacac-----------------agacaaacatccat
A0A1P7YWR9_E1B19K-      -ggtcttcttcatctacac-----------------agacaaacatccat
A0A1P7YXN8_E1B19K-      -ggtcttcttcatctacac-----------------agacaaacatccat
A0A1P8C849_E1B19K-      -ggtcttcttcatctacac-----------------agacaaacatccat
B9A5A7_E1B19K-01        -ggtcttcttcatctacac-----------------agacaaacatccat
                         **   * *   * ****                  **** **  **** 

A0A1P8C849_E1B19K-      ggtgcgcgcttgcgagtgcggtggcagacacaccaggatgcagccagtgg
A0A1P7YYY5_E1B19K-      ggtgcgcgcttgcgagtgcggtggcagacacaccaggatgcagccagtgg
A0A1P7YWR9_E1B19K-      ggtgcgcgcttgcgagtgcggtggcagacacaccaggatgcagccagtgg
A0A1P7YXN8_E1B19K-      ggtgcgcgcttgcgagtgcggtggcagacacaccaggatgcagccagtgg
A0A1P7YWY2_E1B19K-      ggtgcgcgcttgcgagtgcggtggcagacacaccaggatgcagccagtgg
A0A1P7YYY5_E1B19K-      gtt----------------ggaggaagaaata--agg---------gagg
A0A1P7YWY2_E1B19K-      gtt----------------ggaggaagaaatg--agg---------gagt
A0A1P7YWR9_E1B19K-      gtt----------------ggaggaagaaatg--agg---------gagg
A0A1P7YXN8_E1B19K-      gtt----------------ggaggaagaaatg--agg---------gagg
A0A1P8C849_E1B19K-      gtt----------------ggaggaagaaatg--agg---------gagg
B9A5A7_E1B19K-01        gtt----------------ggaggaagaaatg--agg---------gagg
                        * *                ** ** *** *    ***         * * 

A0A1P8C849_E1B19K-      ccctggatgtga--ccgaggagctgcgaccagaccacctggtgatggcct
A0A1P7YYY5_E1B19K-      ctctggatgtga--ccgaggagctgcgaccagaccacctggtgatggcct
A0A1P7YWR9_E1B19K-      ccctggatgtga--ccgaggagctgcgaccagaccacctggtgatggcct
A0A1P7YXN8_E1B19K-      ccctggatgtga--ccgaggagctgcgaccagaccacctggtgatggcct
A0A1P7YWY2_E1B19K-      ccctggatgtga--ccgaggagctgcgaccagaccacctggtgatggcct
A0A1P7YYY5_E1B19K-      ccatggacaagaacccgaggagc----------------------ggcct
A0A1P7YWY2_E1B19K-      ccatggacaagaacccgaggagc----------------------ggcct
A0A1P7YWR9_E1B19K-      ccatggacaagaacccgaggagc----------------------ggcct
A0A1P7YXN8_E1B19K-      ccatggacaagaacccgaggagc----------------------ggcct
A0A1P8C849_E1B19K-      ccatggacaagaacccgaggagc----------------------ggcct
B9A5A7_E1B19K-01        ccatggacaagaacccgaggagc----------------------ggcct
                        *  ****   **  *********                      *****

A0A1P8C849_E1B19K-      gtaccgggaccgagttcagctccagtgg-ggaggacacagattag
A0A1P7YYY5_E1B19K-      gtaccgggaccgagttcagctccagtgg-ggaggacacagattag
A0A1P7YWR9_E1B19K-      gtaccgggaccgagttcagctccagtgg-ggaggacacagattag
A0A1P7YXN8_E1B19K-      gtaccgggaccgagttcagctccagtgg-ggaggacacagattag
A0A1P7YWY2_E1B19K-      gtaccgggaccgagttcagctccagtgg-ggaggacacagattag
A0A1P7YYY5_E1B19K-      ggacc--------------ctccgttggaagaggagctggattaa
A0A1P7YWY2_E1B19K-      ggacc--------------ctccgtcggaagaggagctggattaa
A0A1P7YWR9_E1B19K-      ggacc--------------ctccgtcggaagaggagctggattaa
A0A1P7YXN8_E1B19K-      ggacc--------------ctccgtcggaagaggagctggattaa
A0A1P8C849_E1B19K-      ggacc--------------ctccgtcggaagaggagctggattaa
B9A5A7_E1B19K-01        ggacc--------------ctccgtcggaagaggagctggattaa
                        * ***              ****   **  *****    ***** 

© 1998-2022Legal notice