Dataset for CDS E1B19K of organism Human adenovirus A serotype 18

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

D3JIR7_E1B19K-01      atggagttgga------agctgtgctgcaa--------------------
D3JIR7_E1B19K-02      atggagccagacgtcccagctgagttgggattacatgctggattacatgg
                      ******   **      ***** * **  *                    

D3JIR7_E1B19K-01      ------agttat-cagggcgttcgtca------------gctcttac---
D3JIR7_E1B19K-02      caatgcagctgtggagggcatggctcacgaggagggtttgcatttactcg
                            ** * *  ***** *   ***            **  ****   

D3JIR7_E1B19K-01      --------------------------------------------------
D3JIR7_E1B19K-02      ctggcgcggcctttgaccatgccgcgactgccaacgttgcaggaggagga

D3JIR7_E1B19K-01      -----------------------------agtatacctctaaaaa-----
D3JIR7_E1B19K-02      gctggagcagcgggaccctgcggcggagaagtgaacatggaacaacaggt
                                                   ***  ** *  ** **     

D3JIR7_E1B19K-01      --------------cacttca-----------------------------
D3JIR7_E1B19K-02      gcaagaaggccatgcacttgaccctgaggaagggcccagctgtgcagctg
                                    ***** *                             

D3JIR7_E1B19K-01      -------------------------ggtttttgg--agatatctgt----
D3JIR7_E1B19K-02      ttaacattaagcgggaacgggaaacggttcttagtaggctagctgttaat
                                               **** ** *   * ** ****    

D3JIR7_E1B19K-01      -ttgggtctactttatgc---aaagtggtacatagg--------gtaaaa
D3JIR7_E1B19K-02      ataatgtctcgcccgcgcttagaaactgtgtattggcaggaactgcaaaa
                       *   ****       **    **   **  ** **        * ****

D3JIR7_E1B19K-01      gaag-------------------------actacaggaaggaatttgaaa
D3JIR7_E1B19K-02      tgagtttcagcaaggagatatgcatttacagtacaagtatggttttgagc
                        **                         * **** * * *  *****  

D3JIR7_E1B19K-01      acatactggccggctgtccagggcttttggca--------------tctt
D3JIR7_E1B19K-02      aattaaaaactcactggttagagccttgggaagatattgagagtgctatt
                      *  **    *   ***   ** ** ** ** *              * **

D3JIR7_E1B19K-01      tagatctttgc------------------------caccactcgattttt
D3JIR7_E1B19K-02      aaaacttttgcaaagttagctttacgccctgatcgcagctataaaattag
                       * *  *****                        ** *  *  * **  

D3JIR7_E1B19K-01      caagagaa--------------------------------agtggtcaaa
D3JIR7_E1B19K-02      taaaacaataactattgcttcatatgcttacattattggtaatggtgcaa
                       ** * **                                * ****  **

D3JIR7_E1B19K-01      tctttggatt----------------------------tttcatctgcag
D3JIR7_E1B19K-02      taattgaggtggatacaagtgacagggttgctttcagatgtcgcatgcag
                      *  ***   *                            * **   *****

D3JIR7_E1B19K-01      ggc-----------------------gaacgg--ttgcttctat------
D3JIR7_E1B19K-02      ggcatgggtcctggggtggtggggttgggcggtattacctttattaatgt
                      ***                       *  ***  ** * * ***      

D3JIR7_E1B19K-01      ---------------------------tgcttttttggtaacc-------
D3JIR7_E1B19K-02      tagatttgctggagacaaatttaaaggtactttgtttgaagccaacacca
                                                 * **** ** * * **       

D3JIR7_E1B19K-01      --------------------------------------------------
D3JIR7_E1B19K-02      gccttgttttgcatggtgtttattttcttaattttagtaatacttgtgtg

D3JIR7_E1B19K-01      --gttttagataaat----------ggagccagacgtccca---------
D3JIR7_E1B19K-02      gagtcttggattaaggtttccgcaaggggctgtacgttttatggttgtag
                        ** ** *** **           ** **   ****   *         

D3JIR7_E1B19K-01      -----------------------------------------------gct
D3JIR7_E1B19K-02      gaggggtttagtaggcagaccaaaaagtaaaatgtctgtaaaaaaatgct

D3JIR7_E1B19K-01      gagttg-ggattacatgctggattacatgg--------------------
D3JIR7_E1B19K-02      tgtttgagaaatgcgtgctagccttaattgtggagggggatgcgcatatt
                         *** * * * * **** *  *  ** *                    

D3JIR7_E1B19K-01      -----caatgcagct------------------------gtggagggcat
D3JIR7_E1B19K-02      agacataatgcagcttcagaaaatacatgttttgttctagtgaagggaat
                            *********                        *** **** **

D3JIR7_E1B19K-01      ggct---------cacga----------ggagggt---------------
D3JIR7_E1B19K-02      ggctgttttaaggcacaatatggtttgtggagtgtccgatcaatctgcgc
                      ****         *** *          **** **               

D3JIR7_E1B19K-01      -------------ttgcatttac---------------------------
D3JIR7_E1B19K-02      gccgttatgttacttgcgctgatggaaattgtcatgccttaaaaactatt
                                   ****  * *                            

D3JIR7_E1B19K-01      -----------------------tcgctggc-------------------
D3JIR7_E1B19K-02      catgttgtgagccatgttaaacatcgctggcctgtgtgtgatcataatat

D3JIR7_E1B19K-01      --------------------------------------------------
D3JIR7_E1B19K-02      gtttatgcgttgttccatgcatttaggcttaaggcgtggcatgtttgtgc

D3JIR7_E1B19K-01      --------------------------------------------------
D3JIR7_E1B19K-02      cttttcaatgtaaccttagtcatacaaatgtattgcttgaacctgaggtg

D3JIR7_E1B19K-01      ---------------------gcggcctttgacc----------------
D3JIR7_E1B19K-02      ttttctagaataagtttaaatggggtgtttgacctgtctgtggaattgta
                                           * **  *******                

D3JIR7_E1B19K-01      --------------atgccgcgact-gccaacgttgcaggaggaggagct
D3JIR7_E1B19K-02      taaggttataagatatgatgatactcgtcaccgttgtcgacagtgtgagt
                                    ***  *  *** * ** *****  *   * *    *

D3JIR7_E1B19K-01      ggagcagc--------gggaccctgc------------------------
D3JIR7_E1B19K-02      gtggcagcagtcatctggaactccgccctgttttattgaatgtgacggag
                      *  *****        ** ** * **                        

D3JIR7_E1B19K-01      -ggcggagaagtga------------------------------------
D3JIR7_E1B19K-02      gagctgaggagtgaccaccttaccttatcttgcctgcgaactgactacga
                        ** *** *****                                    

D3JIR7_E1B19K-01      -------------------------
D3JIR7_E1B19K-02      atccagtgatgaagacggcaactaa

© 1998-2023Legal notice