Dataset for CDS adenoviridae of organism Human adenovirus 7d2

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

R4HMC6_E1B19K-01      atgga-----------------------------ggtttgggct------
R4HMC6_E1B19K-02      atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
                      *****                             * *****  *      

R4HMC6_E1B19K-01      ----------------atcttggaagac----------------------
R4HMC6_E1B19K-02      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
                                      * * ****** *                      

R4HMC6_E1B19K-01      ---------------------------------------ctcagaca---
R4HMC6_E1B19K-02      aattactggccagtgcagcctctaggagtagcagggatactgagacaccc
                                                             ** *****   

R4HMC6_E1B19K-01      ---gactaggcta------ctgctagaaaa--------------------
R4HMC6_E1B19K-02      accgaccatgccagcggttctgcaggaggagcagcaggaggacaatccga
                         *** * ** *      ****  **  *                    

R4HMC6_E1B19K-01      ----cgcctcggac-----------ggagtctctggccttt---------
R4HMC6_E1B19K-02      gagccggcctggaccctccggtggaggagtagctgacctgtttcctgaac
                          ** *  ****           *****  *** *** *         

R4HMC6_E1B19K-01      --------------------------------------------------
R4HMC6_E1B19K-02      tgcgacgggtgcttactaggtctacgaccagtggacagaacagaggcatt

R4HMC6_E1B19K-01      -----ggaga----------------------------------------
R4HMC6_E1B19K-02      aagagggagaggaatcctagtgggaataattcaagaaccgagttggcttt

R4HMC6_E1B19K-01      ---------------------ttctg-----gttcggtggt----gatct
R4HMC6_E1B19K-02      aagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggttc
                                           * ***     *** *****     * *  

R4HMC6_E1B19K-01      a--------gctaggctagtgttt---------agga-----------ta
R4HMC6_E1B19K-02      agagcgaaggcagggatgaagtttcaatattgcaggagaaatattcacta
                      *        **  ** *   ****         ****           **

R4HMC6_E1B19K-01      aaac------aggactacagcgtagaatttgaaaagttattggacgacag
R4HMC6_E1B19K-02      gaacaacttaagacctgttggttggaacctgagga-tgattgggaggtgg
                       ***      **  **   *  * ***  ***  * * *****  *   *

R4HMC6_E1B19K-01      tc--caggactt-------------tttgaagctc---------------
R4HMC6_E1B19K-02      ccattaggaattatgctaagatatctctgaggcctgataaacaatataga
                       *   **** **             * *** **                 

R4HMC6_E1B19K-01      -------------ttaacttgggtcat-caggct-cattttaagga----
R4HMC6_E1B19K-02      attactaagaagattaatattagaaatgcatgctacatatcagggaatgg
                                   ****  *  *  ** ** *** *** * * ***    

R4HMC6_E1B19K-01      ---gaaggtt----------------------------------------
R4HMC6_E1B19K-02      ggcagaggttataatagatacacaagataaagcagcttttagatgttgta

R4HMC6_E1B19K-01      ---------------------------------------------ttatc
R4HMC6_E1B19K-02      tgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttatg

R4HMC6_E1B19K-01      agttttagattt----------------------ttctactcctgg-tag
R4HMC6_E1B19K-02      aatattaggtttagaggggatgggtataatggcattgtatttatggctaa
                      * * **** ***                      ** ** *  *** ** 

R4HMC6_E1B19K-01      aact--gctgct--------gctgtagcttttct----------------
R4HMC6_E1B19K-02      cactaagctgattctacatggttgtagcttttttgggtttaataatacgt
                       ***  **** *        * ********** *                

R4HMC6_E1B19K-01      -------------------------------------tactttt------
R4HMC6_E1B19K-02      gtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgca
                                                           ** ****      

R4HMC6_E1B19K-01      --------------------------------------------------
R4HMC6_E1B19K-02      tgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaagaa

R4HMC6_E1B19K-01      ----------------------------atattggataaat---------
R4HMC6_E1B19K-02      atgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagcaa
                                                  *** ** ** **          

R4HMC6_E1B19K-01      ggatccgcc---------------aaac--------tcacttcagcaagg
R4HMC6_E1B19K-02      ggatccgccactgcgcagctacagaaactggctgcttcattctaataaag
                      *********               ****        *** *  *  ** *

R4HMC6_E1B19K-01      g---------------------atacg--ttttggat-ttcatagcagca
R4HMC6_E1B19K-02      ggaaatgccagtgtgaagcataatatgatctgtggacattcggatgagag
                      *                     *** *   * ****  ***  *  **  

R4HMC6_E1B19K-01      gctttg------------------tggagaacatggaag-----------
R4HMC6_E1B19K-02      gccttatcagatgctgacctgcgctggtggacattgcaatattcttgcta
                      ** **                   *** * **** * *            

R4HMC6_E1B19K-01      --------------------gctcgcagga-------------tgaggac
R4HMC6_E1B19K-02      ctgtgcatatcgtttcacatgcacgcaagaaatggcctgtatttgaacat
                                          ** **** **             ***  * 

R4HMC6_E1B19K-01      aatcttaaatta--------------------------------------
R4HMC6_E1B19K-02      aatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaatg
                      *** *   ****                                      

R4HMC6_E1B19K-01      -------ctggccagtgcagc-----------------------------
R4HMC6_E1B19K-02      tttatgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaacc
                             **  ****** * *                             

R4HMC6_E1B19K-01      ---------ctctag---gag--tagcagg--------------------
R4HMC6_E1B19K-02      agatgccttttccagagtgagcttaacaggaatctttgatatgaatattc
                                ** **   ***  ** ****                    

R4HMC6_E1B19K-01      ----------gatactgagaca---------cccaccgaccatgccagcg
R4HMC6_E1B19K-02      aactatggaagatcctgagatatgatgacactaaaccgagggtgc--gcg
                                *** ****** *            *****   ***  ***

R4HMC6_E1B19K-01      gttctgcaggaggag-----------------cagcaggag---------
R4HMC6_E1B19K-02      catgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggat
                        *  * * * ****                 **** ** *         

R4HMC6_E1B19K-01      ------gacaatccgagagccg--------------gcctggacc-----
R4HMC6_E1B19K-02      gtgactgaagacctgagacccgatcatttggtgcttgcctgcactggagc
                            **  * * **** ***              ***** **      

R4HMC6_E1B19K-01      ---------ctccggtggaggag--------tag
R4HMC6_E1B19K-02      ggagttcggttccagtggtgaagaaactgactaa
                                *** **** * **        ** 

© 1998-2020Legal notice