Dataset for CDS E1B19K of organism Human adenovirus 68

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

K7NG43_E1B19K-01      atgga-----------------------------ggtttgggct------
K7NG43_E1B19K-02      atggatccgccaaacccacttcagcaagggatacgttttggatttcatag
                      *****                             * *****  *      

K7NG43_E1B19K-01      ----------------atcttggaagacctg--------agacagac-ta
K7NG43_E1B19K-02      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
                                      * * ****** *  *         ****  * **

K7NG43_E1B19K-01      ggctactgctagaaaacgcctcggacggagtctctggcttttggaga---
K7NG43_E1B19K-02      gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
                      *  *****         ***** *  *****  * **  *   ****   

K7NG43_E1B19K-01      -------------------ttctgg-------------------------
K7NG43_E1B19K-02      ccaccggccatgccagcggttctggaggaggagcagcaggaggacaatcc

K7NG43_E1B19K-01      ------------------ttcggaggtgatctagcta-------------
K7NG43_E1B19K-02      gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
                                        * *** ** *   *****              

K7NG43_E1B19K-01      -----ggctagtgttta-----------------ggataaaacagga---
K7NG43_E1B19K-02      actgcgacgggtgcttactaggtctacgtccagtggacaggacaggggca
                           * *  *** ***                 *** *  *****    

K7NG43_E1B19K-01      ------------------ctacagggaagaatttgaaaagtta-ttggac
K7NG43_E1B19K-02      ttaagagggagaggaatcctagtgggaataatttaagaaccgagttggct
                                        ***  ***** ***** * **   * ****  

K7NG43_E1B19K-01      gacagtcca---------ggactttttgaagctctt--------------
K7NG43_E1B19K-02      ttaagtttaatgagccgtaggcgtcctgaaactgtttggtggcatgaggt
                         ***  *          * * *  **** ** **              

K7NG43_E1B19K-01      --------------------------------------------------
K7NG43_E1B19K-02      tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac

K7NG43_E1B19K-01      ---------------------------aacttg----------------g
K7NG43_E1B19K-02      tagaacaacttaagacctgttggttggaacctgaggatgattgggaagtg
                                                 *** **                *

K7NG43_E1B19K-01      gccatcagg-----------------------------------------
K7NG43_E1B19K-02      gccattaggaattatgctaagatatctctgaggcctgataaacagtatag
                      ***** ***                                         

K7NG43_E1B19K-01      ----------------------------------ctcattttaagga---
K7NG43_E1B19K-02      aattactaagaagattaatattagaaatgcatgctacatattagggaatg
                                                          *** *** ***   

K7NG43_E1B19K-01      ----gaaggt----------------------------------------
K7NG43_E1B19K-02      gggcagaggttataatagatacacaagataaagcagcttttagatgttgt

K7NG43_E1B19K-01      ---------------------------------------------tttat
K7NG43_E1B19K-02      atgatgggtatgtggccaggggttgtcggcatggaagcagtaacatttat

K7NG43_E1B19K-01      cagttttagattt----------------------ttctactcctgg-ta
K7NG43_E1B19K-02      gaatattaggtttagaggggatgggtataatggcattgtatttatggcta
                       * * **** ***                      ** ** *  *** **

K7NG43_E1B19K-01      gaact--gctgct--------gctgtagcttttct-----------tact
K7NG43_E1B19K-02      acactaagctgattctacatggttgtagcttttttggggttaataatact
                        ***  **** *        * ********** *           ****

K7NG43_E1B19K-01      ttt-----------------------------------------------
K7NG43_E1B19K-02      tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
                      * *                                               

K7NG43_E1B19K-01      --------------------------------------------------
K7NG43_E1B19K-02      atgctggattgcaacatcaggtagggtcaagagtcagttgtctgcgaaga

K7NG43_E1B19K-01      -----------------------------atattggataaat--------
K7NG43_E1B19K-02      aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
                                                   *** ** ** **         

K7NG43_E1B19K-01      -ggatccgcc---------------aaac---ccacttcagc------aa
K7NG43_E1B19K-02      agggtccgccactgcgcagctacagaaactggctgcttcattctaataaa
                       ** ******               ****   *  *****        **

K7NG43_E1B19K-01      gggatacgt------------------------------tttggat----
K7NG43_E1B19K-02      gggaaatgccagtgtgaagcataatatgatctgtggacattcggatgaga
                      **** * *                               ** ****    

K7NG43_E1B19K-01      ----ttcatagcagcagctttg---tggagaacatggaag----------
K7NG43_E1B19K-02      gaccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
                          **   **  ** *   **   *** * **** * *           

K7NG43_E1B19K-01      ---------------------gctcgcagga-------------tgagga
K7NG43_E1B19K-02      accgtgcatatcgtttcccatgcacgcaagaaatggcctgtatttgaaca
                                           ** **** **             ***  *

K7NG43_E1B19K-01      caatcttagatta-------------------------------------
K7NG43_E1B19K-02      taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
                       *** *  *****                                     

K7NG43_E1B19K-01      --------ctggccagtgca------------------------------
K7NG43_E1B19K-02      gtttatgccttaccagtgtaacatgaatcatgtgaaggtgatgttggaac
                              **  ****** *                              

K7NG43_E1B19K-01      -----gcctc--------tgggagtagcagg-------------------
K7NG43_E1B19K-02      cagatgccttttccagagtgagtttaacaggaatctttgatatgaatatt
                           ****         ** *  ** ****                   

K7NG43_E1B19K-01      -----------gatactgagac-------------acccaccggccatgc
K7NG43_E1B19K-02      caactatggaagatcctgagatatgatgacactaaaccgagggtgcgcgc
                                 *** ******              *** *  *  *  **

K7NG43_E1B19K-01      cagcggttctggaggagga-----------gcagcaggag----------
K7NG43_E1B19K-02      atgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggatg
                        ***  *  *****                **** ** *          

K7NG43_E1B19K-01      -----gacaatccgagagccg--------------gcctggacc------
K7NG43_E1B19K-02      tgactgaagacctgagacccgatcatttggtgcttgcctgcactggagcg
                           **  * * **** ***              ***** **       

K7NG43_E1B19K-01      --------ctccggtggaggag--------tag
K7NG43_E1B19K-02      gagttcggttctagtggtgaagaaactgactaa
                               **  **** * **        ** 

© 1998-2023Legal notice