Dataset for CDS adenoviridae of organism Human adenovirus 66

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

R4HLA0_E1B19K-01      atgga-----------------------------ggtttgggct------
R4HLA0_E1B19K-02      atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
                      *****                             * *****  *      

R4HLA0_E1B19K-01      ----------------atcttggaagac-ctcagacaga--------cta
R4HLA0_E1B19K-02      cagcagctttgtggagaacatggaaggctcgcaggatgaggacaatctta
                                      * * ****** * * ***   **         **

R4HLA0_E1B19K-01      ggctactgctagaaaacgcctcggacggagtctctggcctttggaga---
R4HLA0_E1B19K-02      gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
                      *  *****         ***** *  *****  * **  *   ****   

R4HLA0_E1B19K-01      -------------------ttctg--------------------------
R4HLA0_E1B19K-02      ccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaatcc

R4HLA0_E1B19K-01      -----------------gttcggtggtgatctagcta-------------
R4HLA0_E1B19K-02      gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
                                        * ****** *   *****              

R4HLA0_E1B19K-01      -----ggctagtgttta-----------------ggataaaacagga---
R4HLA0_E1B19K-02      actgcgacgggtgcttactaggtctacgaccagtggacagaacaggggca
                           * *  *** ***                 *** * ******    

R4HLA0_E1B19K-01      ------------------ctacagggaagaatttga--------------
R4HLA0_E1B19K-02      ttaagagggagaggaatcctagtgggaacaattcaagaaccgagttggct
                                        ***  ***** ****  *              

R4HLA0_E1B19K-01      --aaagttattggacgacag----tccaggactttt--------------
R4HLA0_E1B19K-02      ttaagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggt
                        **  *** **  *  ***     *    *** **              

R4HLA0_E1B19K-01      ------------------tgaagctcttaacttg----------------
R4HLA0_E1B19K-02      tcagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcac
                                        ***** *   *  ***                

R4HLA0_E1B19K-01      -------------------------------------------------g
R4HLA0_E1B19K-02      tagaacaacttaagacctgttggttggaacctgaggatgattgggaggtg

R4HLA0_E1B19K-01      gtcatcagg-ctcattttaag-----------------------------
R4HLA0_E1B19K-02      gccattaggaattatgctaagatatctctgaggcctgataaacaatatag
                      * *** ***  * **  ****                             

R4HLA0_E1B19K-01      -------gagaaggtt----------------------------------
R4HLA0_E1B19K-02      aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
                              ***** **                                  

R4HLA0_E1B19K-01      --------------------------------------------------
R4HLA0_E1B19K-02      gggcagaggttataatagatacacaagataaagcagcttttagatgttgt

R4HLA0_E1B19K-01      ----------------------------------------------ttat
R4HLA0_E1B19K-02      atgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttat

R4HLA0_E1B19K-01      cagttttagattt----------------------ttctactcctgg-ta
R4HLA0_E1B19K-02      gaatattaggtttagaggggatgggtataatggcattgtatttatggcta
                       * * **** ***                      ** ** *  *** **

R4HLA0_E1B19K-01      gaact--gctgct--------gctgtagcttttct---------------
R4HLA0_E1B19K-02      acactaagctgattctacatggttgtagcttttttgggtttaataatacg
                        ***  **** *        * ********** *               

R4HLA0_E1B19K-01      --------------------------------------tactttt-----
R4HLA0_E1B19K-02      tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
                                                            ** ****     

R4HLA0_E1B19K-01      --------------------------------------------------
R4HLA0_E1B19K-02      atgctggattgcaacatcaggtagggtgaagagtcagttgtctgtaaaga

R4HLA0_E1B19K-01      -----------------------------atattggataaat--------
R4HLA0_E1B19K-02      aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
                                                   *** ** ** **         

R4HLA0_E1B19K-01      -ggatccgc---------------caaac--------tcacttcagcaag
R4HLA0_E1B19K-02      agggtccgccactgcgcggctacacaaactggctgcttcattctaataaa
                       ** *****               *****        *** *  *  ** 

R4HLA0_E1B19K-01      gg---------------------atacg--ttttggat-ttcatagcagc
R4HLA0_E1B19K-02      gggaaatgccagtgtaaagcataatatgatctgtggacattcggatgaga
                      **                     *** *   * ****  ***  *  ** 

R4HLA0_E1B19K-01      agctttg------------------tggagaacatggaag----------
R4HLA0_E1B19K-02      ggccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
                       ** **                   *** * **** * *           

R4HLA0_E1B19K-01      ---------------------gctcgcagga-------------tgagga
R4HLA0_E1B19K-02      accgtgcatatcgtttcacatgcacgcaagaaatggcctgtatttgaaca
                                           ** **** **             ***  *

R4HLA0_E1B19K-01      caatcttagatta-------------------------------------
R4HLA0_E1B19K-02      taatgt--gattaccaagtgcaccatgcacataggtggtcgcagaggaat
                       *** *  *****                                     

R4HLA0_E1B19K-01      --------ctggccagtgcagc----------------------------
R4HLA0_E1B19K-02      gtttatgccttaccagtgtaacatgaatcatgtgaaggtgatgttggaac
                              **  ****** * *                            

R4HLA0_E1B19K-01      --------------------------------------------------
R4HLA0_E1B19K-02      cagatgccttttccagagtgagcttaacaggaatctttgatatgaatatt

R4HLA0_E1B19K-01      ---ctctgggagtagcagggatactgagacacc-caccgaccatgccagc
R4HLA0_E1B19K-02      caactatggaagatcctgagatatgatgacactaaaccgagggtgc--gc
                         ** *** **   * * ****    *****   *****   ***  **

R4HLA0_E1B19K-01      ggttctgcaggaggag-----------------cagcaggag--------
R4HLA0_E1B19K-02      gcatgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtgga
                      *  *  * * * ****                 **** ** *        

R4HLA0_E1B19K-01      -------gacaatccgagagccg--------------gcctggacc----
R4HLA0_E1B19K-02      tgtgactgaagacctgagacccgatcatttggtgcttgcctgcactggag
                             **  * * **** ***              ***** **     

R4HLA0_E1B19K-01      ----------ctccggtggaggag--------tag
R4HLA0_E1B19K-02      cggagtttggttctagtggtgaagaaactgactaa
                                 **  **** * **        ** 

© 1998-2022Legal notice