Dataset for CDS adenoviridae of organism Human adenovirus 60a

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

G1FC01_E1B19K-01      atggag-----------------gtgtggactatccttggagactttaac
G1FC01_E1B19K-02      atggagccagaacacccaactgagcaggggcta-cattctggacttcgcg
                      ******                 *   ** *** * **   *****    

G1FC01_E1B19K-01      aagacacgcc-------ggcttgta---------gaggatag--------
G1FC01_E1B19K-02      gccatgcacctgtggagggcctgggtcaggcagcggggacagagaatctt
                         *  * **       *** **           * *** **        

G1FC01_E1B19K-01      --------------ttcagacgggtgctccgggttct-------------
G1FC01_E1B19K-02      gaactactggcttctacagccagcagctccgggtcttcttcgtctacaca
                                    * *** * *  *********  *             

G1FC01_E1B19K-01      --------------------------------------------------
G1FC01_E1B19K-02      gacaaacatccatgttggaggaagaaatgaggcaggccatggacgagaac

G1FC01_E1B19K-01      -----------------------------ggagacactggtttggaactc
G1FC01_E1B19K-02      ccgaggagcggcctggaccctccgtcggaagaggagctggattgaa--tc
                                                    ***   **** *** *  **

G1FC01_E1B19K-01      ctctatctcgcct------------------ggtgtacac----------
G1FC01_E1B19K-02      aggtatccagcctgtacccagagcttagcagggtgctgacatccatggcc
                         ****  ****                  ****   **          

G1FC01_E1B19K-01      -----agttaagaaggattataacgagg----------------------
G1FC01_E1B19K-02      aggggagtgaagagggagaggagcgatgggggcaataccgggatgatgac
                           *** **** ***    * *** *                      

G1FC01_E1B19K-01      -------------aatttga----------------aaatctttttgcc-
G1FC01_E1B19K-02      agagctgacggccagtctgatgaatcgcaagcgcccagagcgcattacct
                                   * * ***                * * *   ** ** 

G1FC01_E1B19K-01      -----------------gactgc---------------------------
G1FC01_E1B19K-02      ggcacgagctacagcaggagtgcagggatgagataggcctgatgcaggat
                                       ** ***                           

G1FC01_E1B19K-01      ---tctggcctg--------------------------------------
G1FC01_E1B19K-02      aaatatggcctggagcagataaaaacccactggttgaacccagatgagga
                         * *******                                      

G1FC01_E1B19K-01      -------------------------------------------cttgatt
G1FC01_E1B19K-02      ttgggaggaggccattaagaaatatgccaagatagccctgcgcccagatt
                                                                 *  ****

G1FC01_E1B19K-01      ---------------------ctctgaattttggcca--ccagtcccttt
G1FC01_E1B19K-02      gcaagtacagggtgaccaagaccgtgaatatcagacatgcctgctacatc
                                           *  ***** *  * **  ** *   * * 

G1FC01_E1B19K-01      tccaggaaag----------ggtcctccacagcct---------------
G1FC01_E1B19K-02      tcagggaacggggcagaggtggtcatcgataccctggacaaggccgcctt
                      **  **** *          **** ** * * ***               

G1FC01_E1B19K-01      --------------------------------------------------
G1FC01_E1B19K-02      caggtgttgcatgatgggaatgagagccggagtgatgaatatgaattcca

G1FC01_E1B19K-01      ---------------------------------------------tgatt
G1FC01_E1B19K-02      tgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgatg

G1FC01_E1B19K-01      tttccagcc--------cagggcgcactacagccggggttgcttt-----
G1FC01_E1B19K-02      ttcatggccaacagccacatgaccctgcacggatgcagtttcttcggctt
                      **    ***        ** * * *   ** *  *  *** ***      

G1FC01_E1B19K-01      ----------------------------------------------tgtg
G1FC01_E1B19K-02      caacaatatgtgtgccgaggtgtggggcgctgctaagatcaggggatgta

G1FC01_E1B19K-01      gtttttctggttgacaaatgg----agccagaacacccaa----------
G1FC01_E1B19K-02      agttttatggctgctggatgggcgtggtcggaagacccaagagcgagatg
                        **** *** **    ****     * * *** ******          

G1FC01_E1B19K-01      -ctg---agcag--------------------------------------
G1FC01_E1B19K-02      tctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctaccga
                       ***   *****                                      

G1FC01_E1B19K-01      ---------------------------------------gggctacattc
G1FC01_E1B19K-02      gggcaatgctagagtgagacattgctcttccttggagacgggctgc-ttc
                                                             ***** * ***

G1FC01_E1B19K-01      t-------------------------------------------ggactt
G1FC01_E1B19K-02      tgcctggtgaagggcacagcctctctgaagcataatatggtgaagggctg
                      *                                           ** ** 

G1FC01_E1B19K-01      cgcgg---------------ccatgc--acctgtg----gagggcctg--
G1FC01_E1B19K-02      cacggatgagcgcatgtacaacatgctgacctgcgactcgggggtctgtc
                      * ***                *****  ***** *    * *** ***  

G1FC01_E1B19K-01      --------------------------------------------------
G1FC01_E1B19K-02      atatcctgaagaacatccatgtgacctcccaccccagaaagaagtggcca

G1FC01_E1B19K-01      --------------------ggtcagg-----------------------
G1FC01_E1B19K-02      gtgtttgagaataacctgctgatcaagtgccatatgcacctgggtgccag
                                          * *** *                       

G1FC01_E1B19K-01      -------------cagcggggacagagaatcttgaacta-----------
G1FC01_E1B19K-02      aaggggcaccttccagccgtaccagtgcaactttagccagaccaagctgc
                                   **** *   *** * * *** * * *           

G1FC01_E1B19K-01      ------------ctggcttctacag-----------ccagcagctccg--
G1FC01_E1B19K-02      tgttggagaacgatgccttctccagggtgaacctgaacggcatctttgac
                                   ** ***** ***            * *** **  *  

G1FC01_E1B19K-01      --ggtcttcttcgtctacac-----------------agacaaacatcca
G1FC01_E1B19K-02      atggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtcca
                        **   ***  ** ****                  **** **  ****

G1FC01_E1B19K-01      tgtt----------------ggaggaagaaat-----gaggca------g
G1FC01_E1B19K-02      gggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagccagtg
                       * *                ** ** *** *      ** ***      *

G1FC01_E1B19K-01      gccatggacgagaacccgaggagc----------------------ggcc
G1FC01_E1B19K-02      gccctggatgtga--ccgaggagctgagaccagaccacctggtgatggcc
                      *** **** * **  *********                      ****

G1FC01_E1B19K-01      tggacc--------------ctccgtcggaagaggagctggattga
G1FC01_E1B19K-02      tgtaccgggaccgagttcagctccagtgg-ggaggacacagattag
                      ** ***              ****   **  *****    ****  

© 1998-2022Legal notice