Dataset for CDS E1B19K of organism Human adenovirus 58

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

E9P585_E1B19K-01      atggatgtgtggactatccttgcagactttagcaagacacgccggcttgt
E9P585_E1B19K-02      --------------------------------------------------

E9P585_E1B19K-01      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
E9P585_E1B19K-02      --------------------------------------------------

E9P585_E1B19K-01      ctcctctatctcgcctggtgtacacagttaagaaggattataaagaggaa
E9P585_E1B19K-02      --------------------------------------------------

E9P585_E1B19K-01      tttgaaaatctttttgctgactgctctggtctgctagattctctgaatct
E9P585_E1B19K-02      --------------------------------------------------

E9P585_E1B19K-01      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
E9P585_E1B19K-02      --------------------------------------------------

E9P585_E1B19K-01      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
E9P585_E1B19K-02      --------------------------------------------------

E9P585_E1B19K-01      gacaaatggagccaggacacccaactgagcaggggctacatcctggactt
E9P585_E1B19K-02      -----atggagccaggacacccaactgagcaggggctacatcctggactt

E9P585_E1B19K-01      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
E9P585_E1B19K-02      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa

E9P585_E1B19K-01      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta
E9P585_E1B19K-02      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta

E9P585_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
E9P585_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga

E9P585_E1B19K-01      gaacccgaggagcggcctggaccctccgttggaagaggagctggattga-
E9P585_E1B19K-02      gaacccgaggagcggcctggaccctccgttggaagaggagctggattgaa

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      tcaggtatccagcctgtacccagagcttagcaaggtgctgacaaccatgg

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      ccaggggagtgaagagggagaggagtgatgggggcaataccgggatgatg

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      accgagctgactgccagcctgatgaatcggaagcgcccagagcgccttac

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      ctggtacgagctacagcaggagtgcagggatgagataggcctgatgcagg

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      ataaatatggcctggagcagataaaaactcactggttgaacccagatgag

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      gattgggaggaggccataaagaaatatgccaagatagccctgcgcccaga

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      ttgcaagtacatagtgaccaagacggtgaatatcagacatgcctgctaca

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      tctcagggaacggggcagaggtggtcatcgataccctggacaagtcagca

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      ttcaggtgttgcatgatgggaatgagagccggagtgatgaatatgaattc

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      catgatcttcatgaacatgaagttcaatggagagaagtttaatggggtgc

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      tgttcatggccaacagccacatgaccctgcatggttgcagcttcttcggt

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      ttcaacaacatgtgcgccgaggtctggggagctgctaagatcaggggctg

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      taagttttatggctgctggatgggcgtggtcggaagacccaagagcgaga

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      tgtctgtgaagcagtgtgtgtttgagaagtgctacctgggggtgtctaca

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      gagggcaatgctagagtgagacattgctcttccctggagacgggctgctt

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      ctgcctggtgaagggcacagcttcgatcaagcataatgtggtgaaaggct

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      gcacggatgagcgcatgtacaacatgctgacctgcgactcaggggtctgt

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      tatatcctgaagaacatccatgtgaccgcccaccccagaaagaagtggcc

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      agtgtttgagaataacctgctaatcaagtgccatatgcacctgggagcca

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      gaaggggcaccttccagccgtaccagtgcaactttagccagaccaagctg

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      ctgttggagaacgatgccttctccagggtgaacctgaacggcatctttga

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      catggatgtctcggtgtacaagatcctgagatacgatgaaaccaggtcca

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      gggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagcctgtg

E9P585_E1B19K-01      --------------------------------------------------
E9P585_E1B19K-02      gccctggatgtgacagaggagctgagaccagaccacctggtgatggcctg

E9P585_E1B19K-01      -------------------------------------------
E9P585_E1B19K-02      taccgggaccgagttcagctccagtggggaggacacagattag

© 1998-2022Legal notice