Dataset for CDS adenoviridae of organism Human adenovirus 55

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C7SRS7_E1B19K-01        atggaggtttgggccattttggaagaccttagaaagactaggcaactgtt
A0A7G5FB98_E1B19K-      atggaggtttgggccattttggaagaccttagaaagactaggcaactgtt
A0A7G5F9T0_E1B19K-      atggaggtttgggccattttggaagaccttagaaagactaggcaactgtt
J7H4R9_E1B19K-01        atggaggtttgggccattttggaagaccttagaaagactaggcaactgtt
                        **************************************************

C7SRS7_E1B19K-01        agagaacgcttcggacggagtctccggtttttggagattctggttcgcta
A0A7G5FB98_E1B19K-      agagagcgcttcggacggagtctccggtttttggagattctggttcgcta
A0A7G5F9T0_E1B19K-      agagaacgcttcggacggagtctccggtttttggagattctggttcgcta
J7H4R9_E1B19K-01        agagaacgcttcggacggagtctccggtttttggagattctggttcgcta
                        ***** ********************************************

C7SRS7_E1B19K-01        gtgaaatagctagggtagtttttaggataaaacaggactataaagaagaa
A0A7G5FB98_E1B19K-      gtgaattagctagggtagtttttaggataaaacaggactataaagaagaa
A0A7G5F9T0_E1B19K-      gtgaattagctagggtagtttttaggataaaacaggactataaagaagaa
J7H4R9_E1B19K-01        gtgaattagctagggtagtttttaggataaaacaggactataaagaagaa
                        ***** ********************************************

C7SRS7_E1B19K-01        tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
A0A7G5FB98_E1B19K-      tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
A0A7G5F9T0_E1B19K-      tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
J7H4R9_E1B19K-01        tttgaaaagttgttggtagattgcccaggactttttgaagctcttaattt
                        **************************************************

C7SRS7_E1B19K-01        gggtcatcaagttcactttaaagaaaaagttttatcagttttagactttt
A0A7G5FB98_E1B19K-      gggtcatcaagttcactttaaagaaaaagttttatcagttttagactttt
A0A7G5F9T0_E1B19K-      gggtcatcaagttcactttaaagaaaaagttttatcagttttagactttt
J7H4R9_E1B19K-01        gggtcatcaagttcactttaaagaaaaagttttatcagttttagactttt
                        **************************************************

C7SRS7_E1B19K-01        cgaccccaggtagaactgctgctgctgtggcttttcttacttttatatta
A0A7G5FB98_E1B19K-      cgaccccaggtagaactgccgctgctgtggcttttcttacttttatatta
A0A7G5F9T0_E1B19K-      cgaccccaggtagaactgccgctgctgtggcttttcttacttttatatta
J7H4R9_E1B19K-01        cgaccccaggtagaactgccgctgctgtggcttttcttacttttatatta
                        ******************* ******************************

C7SRS7_E1B19K-01        gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
A0A7G5FB98_E1B19K-      gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
A0A7G5F9T0_E1B19K-      gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
J7H4R9_E1B19K-01        gataaatggatcccgcagactcatttcagcaggggatacgttttggattt
                        **************************************************

C7SRS7_E1B19K-01        cgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
A0A7G5FB98_E1B19K-      cgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
A0A7G5F9T0_E1B19K-      cgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
J7H4R9_E1B19K-01        cgtagccacagcattgtggagaacatggaaggttcgcaagatgaggacaa
                        **************************************************

C7SRS7_E1B19K-01        tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
A0A7G5FB98_E1B19K-      tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
A0A7G5F9T0_E1B19K-      tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
J7H4R9_E1B19K-01        tcttaggttactggccagtgcagcctttgggtgtagcgggaatcctgagg
                        **************************************************

C7SRS7_E1B19K-01        catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
A0A7G5FB98_E1B19K-      catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
A0A7G5F9T0_E1B19K-      catctaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
J7H4R9_E1B19K-01        catccaccggtcatgccagcggttctggaggaggaacagcaagaggacaa
                        **** *********************************************

C7SRS7_E1B19K-01        cccgagagccggcctggaccctccagtggaggaggcggagtag
A0A7G5FB98_E1B19K-      cccgagagccggcctggaccctccagtggaggaggcggagtag
A0A7G5F9T0_E1B19K-      cccgagagccggcctggaccctccagtggaggaggcggagtag
J7H4R9_E1B19K-01        cccgagagccggcctggaccctccagtggaggaggcggagtag
                        *******************************************

© 1998-2022Legal notice