Dataset for CDS adenoviridae of organism Human adenovirus 53

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q9FFS0_E1B19K-      atggatgtgtggagtatccttgcagactttagcaagacacgccgacttgt
E5RWD9_E1B19K-01        atggatgtgtggactatccttgcagactttagcaagacacgccgacttgt
E5RWL1_E1B19K-01        atggatgtgtggactatccttgcagactttagcaagacacgccgacttgt
                        ************* ************************************

A0A3Q9FFS0_E1B19K-      agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
E5RWD9_E1B19K-01        agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
E5RWL1_E1B19K-01        agaggatagttcagacgggtgctccgggttctggagacactggtttggaa
                        **************************************************

A0A3Q9FFS0_E1B19K-      ctcctctatctcgtctggtgtacacagttaagaaggattataacgaggaa
E5RWD9_E1B19K-01        ctcctctatctcgtctggtgtacacagttaagaaggattataacgaggaa
E5RWL1_E1B19K-01        ctcctctatctcgtctggtgtacacagttaagaaggattataacgaggaa
                        **************************************************

A0A3Q9FFS0_E1B19K-      tttgaaaatctttttgctgattgctctggcctgctagattctctgaatct
E5RWD9_E1B19K-01        tttgaaaatctttttgctgattgctctggcctgctagattctctgaatct
E5RWL1_E1B19K-01        tttgaaaatctttttgctgattgctctggcctgctagattctctgaatct
                        **************************************************

A0A3Q9FFS0_E1B19K-      cggccaccagtcccttttccaggaaagggtactccacagccttgattttt
E5RWD9_E1B19K-01        cggccaccagtcccttttccaggaaagggtactccacagccttgattttt
E5RWL1_E1B19K-01        cggccaccagtcccttttccaggaaagggtactccacagccttgattttt
                        **************************************************

A0A3Q9FFS0_E1B19K-      ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
E5RWD9_E1B19K-01        ccagcccagggcgcactacagccggggttgcttgtgtggtttttctggtt
E5RWL1_E1B19K-01        ccagcccagggcgcactacagccggggttgcttttgtggtttttctggtt
                        ********************************* ****************

A0A3Q9FFS0_E1B19K-      gacaaatggagccagaacacccaactgagcaggggctacattctggactt
E5RWD9_E1B19K-01        gacaaatggagccagaacacccaactgagcaggggctacattctggactt
E5RWL1_E1B19K-01        gacaaatggagccagaacacccaactgagcaggggctacattctggactt
                        **************************************************

A0A3Q9FFS0_E1B19K-      tgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa
E5RWD9_E1B19K-01        cgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa
E5RWL1_E1B19K-01        cgcagccatgcacctgtggagggcatgggtgaggcagcggggacagagaa
                         *************************************************

A0A3Q9FFS0_E1B19K-      tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
E5RWD9_E1B19K-01        tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
E5RWL1_E1B19K-01        tcttgaactactggcttatacagccagcagctccgggtcttcttcgtcta
                        **************************************************

A0A3Q9FFS0_E1B19K-      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
E5RWD9_E1B19K-01        cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
E5RWL1_E1B19K-01        cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
                        **************************************************

A0A3Q9FFS0_E1B19K-      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
E5RWD9_E1B19K-01        gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
E5RWL1_E1B19K-01        gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga
                        *************************************************

© 1998-2020Legal notice