Dataset for CDS E1B19K of organism Human adenovirus 52

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0MK43_E1B19K-01      atggatc------------------tcttggg------------------
A0MK43_E1B19K-02      atggagcaacagcgacagccacctgtcgtgggagtacatgctggattaca
                      ***** *                  ** ****                  

A0MK43_E1B19K-01      --------------------------------------------------
A0MK43_E1B19K-02      tggcgatggctctgtggagggccatgctgcggaggagggtttgcatttac

A0MK43_E1B19K-01      ---------------------------------------------gaact
A0MK43_E1B19K-02      ttgcgggcgcagcctccgcggctggaccgagtggtggaggagaacgagcc
                                                                   ** * 

A0MK43_E1B19K-01      tgagg-------gaatttga-------------------cgtggttcgcc
A0MK43_E1B19K-02      ggaggagaccgagaatctgagagccggcctggaccctccagtggaagact
                       ****       **** ***                    ****    * 

A0MK43_E1B19K-01      gcttgctggagttggcctctg-----------------------------
A0MK43_E1B19K-02      aggtgctgaggatgatc-ctgaagaggggactagtgggggtgctaggaaa
                         *****  * **  * ***                             

A0MK43_E1B19K-01      ----acaaaact---tccaggctttggaggttt-----tggtttggctca
A0MK43_E1B19K-02      aagcaaaaaactgagcctgaacctagaaactttttgaatgagttgactgt
                          * ******    *    * * * *  ***     **  *** **  

A0MK43_E1B19K-01      acgctta--------gcagcgt--------agtttatagggtaaaaagag
A0MK43_E1B19K-02      aagcctaatgaatcggcagcgtcctgagacggtgttttgggctgagttgg
                      * ** **        *******         ** * * ***   *    *

A0MK43_E1B19K-01      agcaggag------------------------------------------
A0MK43_E1B19K-02      aggatgagttcaagaagggggaattaaacctcttgtacaagtatgggttt
                      ** * ***                                          

A0MK43_E1B19K-01      gcgcagt-------ttgctag-----gctgttggccgata---------c
A0MK43_E1B19K-02      gagcagttgaaaactcactggttggagccgtgggaggatatggaaatggc
                      * *****       *  ** *     ** ** **  ****         *

A0MK43_E1B19K-01      tcctggagttttt------gtggctctg----------------------
A0MK43_E1B19K-02      tctagacacctttgctaaagtggctctgcggccggataaagtttacacta
                      **  *     ***      *********                      

A0MK43_E1B19K-01      -----------------------------------gatctaggccatcac
A0MK43_E1B19K-02      ttcgccgcactgttaatataaaaaagagtgtttatgttattggtcatgga
                                                         * * * ** ***   

A0MK43_E1B19K-01      tctcttttccaagagaaaatca----------------------------
A0MK43_E1B19K-02      gctctggtgcaggtgcagaccccagaccgggtggctttcaattgcggcat
                       ****  * ** * * * * *                             

A0MK43_E1B19K-01      ---------------------------------------------tcaaa
A0MK43_E1B19K-02      gcagagtttgggccccggggtgataggtttgaatggagttacatttcaaa

A0MK43_E1B19K-01      a----------act-----taacttttacgtctcctggt----------c
A0MK43_E1B19K-02      atgtcagatttactggtgataattttaatggctctgtgtttgtgactagc
                      *          ***     *** *** * * ***   **          *

A0MK43_E1B19K-01      gcacggttg--cttccgctgcctttattacctatattt------------
A0MK43_E1B19K-02      acccagctaaccctccacggtgtttacttttttaactttaacaatacatg
                       * * * *   * *** * *  **** *   *  * **            

A0MK43_E1B19K-01      --tggatcaatggagc------------aacagcgacagccacc------
A0MK43_E1B19K-02      tgtggagtcatggggtagggtgtctctgaggggctgcagttttcatggtt
                        ****   **** *             *   **  ***    *      

A0MK43_E1B19K-01      -------------------------------tgtcgtg--------ggag
A0MK43_E1B19K-02      gctggaaggcggtggtgggaagaattaaaagtgtcatgtctgtgaagaaa
                                                     **** **        * * 

A0MK43_E1B19K-01      tacatgctggattacatggcgatggctct----gtggagggccatg----
A0MK43_E1B19K-02      tgcatatttgaacgctgtgtgatagctctagcagtagaggggtacggacg
                      * ***  * **   *   * *** *****    ** *****  * *    

A0MK43_E1B19K-01      --------------------ctgcggaggagggtttgcatttac------
A0MK43_E1B19K-02      gatcaggaataacgccgcatctgagaatggatgttttcttttgctgaaag
                                          *** * * *   **** * *** *      

A0MK43_E1B19K-01      ----------------------------ttgcgggcgcagcct-------
A0MK43_E1B19K-02      gtacggccagcgttaagcataatatgatttgcggcagcggcctgtgcccc
                                                  ******  ** ****       

A0MK43_E1B19K-01      --------------------------------------------------
A0MK43_E1B19K-02      tcgcagctcttaacttgcgcagatggaaattgtcacaccttgcgcaccgt

A0MK43_E1B19K-01      ---------------------ccgcggctggac-----------------
A0MK43_E1B19K-02      gcacatagtgtcccactcgcgccgcacctggccaacatttgagcacaata
                                           ****  **** *                 

A0MK43_E1B19K-01      --------------------------------------------------
A0MK43_E1B19K-02      tgctcatgcgttgtgccgttcacctaggtgctagacgcggcgtgtttatg

A0MK43_E1B19K-01      --------------------------------------------------
A0MK43_E1B19K-02      ccttaccaatgtaactttagccatactaagattttgctggaaactgattc

A0MK43_E1B19K-01      -------cgagt------------ggtg----------------------
A0MK43_E1B19K-02      cttccctcgagtatgttttaatggggtgtttgacatgtcaatggaacttt
                             *****            ****                      

A0MK43_E1B19K-01      -----------------gaggagaacgag---------------------
A0MK43_E1B19K-02      ttaaagtgataagatatgatgaaaccaagtctcgttgtcgctcatgtgaa
                                       ** ** * * **                     

A0MK43_E1B19K-01      ------------------------------------ccggaggagaccga
A0MK43_E1B19K-02      tgcggagctaatcatttgaggttgtatcctgtaaccctgaacgttaccga
                                                          * * * *  *****

A0MK43_E1B19K-01      gaatctgagagccggcc--------------------tggacc-------
A0MK43_E1B19K-02      ggagctgaggacggaccaccacatgctgtcttgcctgcgtaccgactatg
                      * * *****  * * **                     * ***       

A0MK43_E1B19K-01      -ctccagtg--gaagactag
A0MK43_E1B19K-02      aatccagcgatgaggagtga
                        ***** *  ** ** *  

© 1998-2022Legal notice