Dataset for CDS E1B19K of organism Human adenovirus 50

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q3ZKW2_E1B19K-01      atgga-----------------------------ggtttgggct------
Q3ZKW2_E1B19K-02      atggatccgacaaacccacttcagcaagggatacgttttggatttcatag
                      *****                             * *****  *      

Q3ZKW2_E1B19K-01      ----------------atcttggaagacctgagaca----gac-----ta
Q3ZKW2_E1B19K-02      cagcagctttgtggagaacatggaaggctcgcagcatgaggacaatctta
                                      * * ****** *  *   **    ***     **

Q3ZKW2_E1B19K-01      ggctactgctagaaaacgcctcggacggagtctctggcttttggaga---
Q3ZKW2_E1B19K-02      gattactggccagtgcagcctctg--ggagtagcagggatactgagacac
                      *  *****         ***** *  *****  * **  *   ****   

Q3ZKW2_E1B19K-01      -------------------ttctgg-------------------------
Q3ZKW2_E1B19K-02      ccaccgaccatgccagcggttctggaggaggagcagcaggaggacaatcc

Q3ZKW2_E1B19K-01      ------------------ttcggtggtgatctagcta-------------
Q3ZKW2_E1B19K-02      gagagccggcctggaccctccggtggaggagtagctgacctgtttcctga
                                        * ****** *   *****              

Q3ZKW2_E1B19K-01      -----ggctagtgttta-----------------ggataaaacagga---
Q3ZKW2_E1B19K-02      actgcgacgggtgcttactaggtctacgtccagtggacaggacaggggca
                           * *  *** ***                 *** *  *****    

Q3ZKW2_E1B19K-01      ------------------ctacagggaagaatttgaaaagtta-ttggac
Q3ZKW2_E1B19K-02      ttaagagggaaaggaatcctagtgggaataattcaagaaccgagttggct
                                        ***  ***** ****  * **   * ****  

Q3ZKW2_E1B19K-01      gacagtcca---------ggactttttgaagctcttaacttgggccatca
Q3ZKW2_E1B19K-02      ttaagtttaatgagccgtaggcgtcctgaaactgtt---tggtggcatga
                         ***  *          * * *  **** ** **   * * * *** *

Q3ZKW2_E1B19K-01      ggctca--------------------tttta-------aggagaaggttt
Q3ZKW2_E1B19K-02      ggttcagagcgaaggcagggatgaagtttcaatattgcaggagaaatatt
                      ** ***                    *** *       *******   **

Q3ZKW2_E1B19K-01      tat-----cagttttagatttttctact----cctgg-------------
Q3ZKW2_E1B19K-02      cactagaacaacttaagacctgttggttggaacctgaggatgattgggag
                       *      **  ** ***  * *    *    ****              

Q3ZKW2_E1B19K-01      --------tagaactgctgctgctgtagctttt-----------------
Q3ZKW2_E1B19K-02      gtggccattaggaattatgctaagatatctctgaggcctgataaacagta
                              *** * *  ****    ** ** *                  

Q3ZKW2_E1B19K-01      ----cttact-------tttatattggata--------------------
Q3ZKW2_E1B19K-02      tagaattactaaaaagattaatattagaaatgcatgctacatatcaggga
                           *****       ** ***** ** *                    

Q3ZKW2_E1B19K-01      ----------------aatggatcc----gacaaacccact---------
Q3ZKW2_E1B19K-02      atggggcagaggttataatagatacccaagataaagcagcttttagatgt
                                      *** *** *    ** *** *  **         

Q3ZKW2_E1B19K-01      ----------------------------tcagcaaggga-----------
Q3ZKW2_E1B19K-02      tgtatgatgggtatgtggccaggggttgtcggcatggaagcagtaacatt
                                                  ** *** ** *           

Q3ZKW2_E1B19K-01      ---------tacgttt--------tggatttcatagca------------
Q3ZKW2_E1B19K-02      tatgaatattaggtttaaaggggatgggtataatggcattgtatttatgg
                               ** ****        *** * * ** ***            

Q3ZKW2_E1B19K-01      ---------------------------gcagct-----------------
Q3ZKW2_E1B19K-02      ctaacactaagctgattctacatggttgtagcttttttgggtttaataat
                                                 * ****                 

Q3ZKW2_E1B19K-01      --ttgtggagaacatggaaggc----------------------------
Q3ZKW2_E1B19K-02      acttgtgtagaagcttgggggcaagttggtgtgaggggttgtagttttta
                        ***** ****  * *  ***                            

Q3ZKW2_E1B19K-01      -----------tcgcagcatgagg--------------------------
Q3ZKW2_E1B19K-02      tgcatgctggattgcaacatcaggtagggtcaagagtcagttgtctgtga
                                 * *** *** ***                          

Q3ZKW2_E1B19K-01      ---------------------acaatcttagattactg------------
Q3ZKW2_E1B19K-02      agaaatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaa
                                             ****** *  *****            

Q3ZKW2_E1B19K-01      ----------gcca--gtgcagcctctgggagtagcag------------
Q3ZKW2_E1B19K-02      gcaagggtccgccactgcgcagctacagaaactggctgcttcattctaat
                                ****  * *****  * *  * * ** *            

Q3ZKW2_E1B19K-01      --------------------------------------------------
Q3ZKW2_E1B19K-02      aaagggaaatgccagtgtgaagcataatatgatctgtggacattcgaatg

Q3ZKW2_E1B19K-01      ------------ggatactga------------gacac------------
Q3ZKW2_E1B19K-02      agaggccttatcagatgctgacttgcgctggtggacattgcaatattctt
                                   *** ****            ****             

Q3ZKW2_E1B19K-01      -ccaccg-------------------------------------------
Q3ZKW2_E1B19K-02      gctaccgtgcatatcgtttcccatgcacgcaagaaatggcctgtatttga
                       * ****                                           

Q3ZKW2_E1B19K-01      ----------------------accatgc-------------cagcgg--
Q3ZKW2_E1B19K-02      acataatgtgattaccaagtgcaccatgcacataggtggtcgcaggggaa
                                            *******             *** **  

Q3ZKW2_E1B19K-01      --------------------------------------------------
Q3ZKW2_E1B19K-02      tgtttatgccttaccagtgtaacatgaatcatgtgaaggtgatgttggaa

Q3ZKW2_E1B19K-01      -----------ttctggaggaggagcagcaggag----------------
Q3ZKW2_E1B19K-02      ccagatgccttttccagagtgagcttaacaggaatctttgatatgaatat
                                 ***  ***   *   * *****                 

Q3ZKW2_E1B19K-01      --------------------------------------------------
Q3ZKW2_E1B19K-02      tcaactatggaagatactgagatatgatgacactaaaccgagggtgcgcg

Q3ZKW2_E1B19K-01      --------------------------------------------------
Q3ZKW2_E1B19K-02      catgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtggat

Q3ZKW2_E1B19K-01      ------gacaatccgagagccg--------------gcctggacc-----
Q3ZKW2_E1B19K-02      gtgactgaagacctgagacccgatcatttggtgcttgcctgcactggagc
                            **  * * **** ***              ***** **      

Q3ZKW2_E1B19K-01      ---------ctccggtggaggag--------tag
Q3ZKW2_E1B19K-02      ggagttcggttctagtggtgaagaaactgactaa
                                **  **** * **        ** 

© 1998-2023Legal notice